Incidental Mutation 'IGL02837:Kit'
ID391906
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #IGL02837 (G1)
Quality Score118
Status Validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75639008 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 467 (V467I)
Ref Sequence ENSEMBL: ENSMUSP00000116465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
Predicted Effect probably benign
Transcript: ENSMUST00000005815
AA Change: V467I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: V467I

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136002
Predicted Effect probably benign
Transcript: ENSMUST00000144270
AA Change: V467I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: V467I

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151357
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,957,581 V786I probably benign Het
Adamts13 A G 2: 26,991,420 N803S probably benign Het
Ago4 C G 4: 126,497,300 G730R possibly damaging Het
Amn T A 12: 111,271,899 M55K possibly damaging Het
Apob A T 12: 8,005,102 Y1334F probably damaging Het
Arl14ep A C 2: 106,969,229 L89R probably damaging Het
Bcam T G 7: 19,764,186 E304A probably damaging Het
Car10 A T 11: 93,597,251 Y258F probably damaging Het
Cerk T A 15: 86,144,695 K387* probably null Het
Chac2 T C 11: 30,977,496 N141S probably damaging Het
Clpx T G 9: 65,324,259 L556R probably damaging Het
Csgalnact2 T C 6: 118,124,403 I297V probably benign Het
Cul1 T C 6: 47,523,205 V650A probably benign Het
Dnah5 A T 15: 28,269,400 E895D probably benign Het
Dnah9 T C 11: 65,874,196 K3841E probably damaging Het
Dpys A G 15: 39,857,305 S20P probably damaging Het
Fat1 G A 8: 45,017,434 V1490I probably benign Het
Flg2 T G 3: 93,201,737 C357W probably damaging Het
Flt1 T A 5: 147,655,170 D494V probably benign Het
Fpr-rs4 T A 17: 18,022,251 D173E probably benign Het
Gm2666 G T 1: 85,485,103 noncoding transcript Het
Gm3867 C A 9: 36,257,800 noncoding transcript Het
Gm5436 A T 12: 84,258,600 noncoding transcript Het
Krtap4-16 A G 11: 99,851,037 V179A unknown Het
Lrp8 C A 4: 107,861,281 H693Q probably benign Het
Lrrc49 A G 9: 60,610,322 S75P probably benign Het
Ltbp4 C A 7: 27,314,381 V1068L probably damaging Het
Magel2 C T 7: 62,378,260 P304L possibly damaging Het
Muc19 T A 15: 91,882,656 noncoding transcript Het
Npas3 T C 12: 53,947,197 V175A possibly damaging Het
Nr1h4 A T 10: 89,516,480 H8Q probably benign Het
Ntsr2 G A 12: 16,653,875 V126M probably damaging Het
Odf2 A T 2: 29,926,713 T725S probably damaging Het
Olfr12 T C 1: 92,620,682 Y259H possibly damaging Het
Olfr183 C T 16: 59,000,546 P287L probably damaging Het
Olfr603 C T 7: 103,383,615 C129Y probably damaging Het
Pgr T C 9: 8,946,638 probably benign Het
Pik3c2g T A 6: 139,626,564 C249* probably null Het
Plcd3 C T 11: 103,071,103 V726M possibly damaging Het
Prl8a1 A G 13: 27,575,634 L140P probably damaging Het
Prpf6 C A 2: 181,622,263 D239E probably damaging Het
Rcc1 C T 4: 132,337,756 R152H probably benign Het
Rimbp2 G T 5: 128,797,745 Q268K probably damaging Het
Rps19-ps13 A T 18: 40,726,394 noncoding transcript Het
Sema4c C A 1: 36,552,884 G266V probably damaging Het
Sema4g T C 19: 44,996,711 F156S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Speer4f1 G T 5: 17,480,383 L225F unknown Het
Thrap3 T C 4: 126,165,364 probably benign Het
Tnfrsf8 T C 4: 145,268,998 E497G probably benign Het
Trim3 T C 7: 105,612,656 N631S probably damaging Het
Trim45 C T 3: 100,931,627 T615I probably benign Het
Wdr43 A G 17: 71,642,736 D445G probably benign Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
Casper UTSW 5 75645875 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
R6805:Kit UTSW 5 75652808 missense probably damaging 1.00
R6848:Kit UTSW 5 75607212 missense probably benign
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAAGTCCACATCCAACCTTG -3'
(R):5'- TGGTAGACAGAGCCTAAACACC -3'

Sequencing Primer
(F):5'- GTGCCTTGCTCGCTCACAG -3'
(R):5'- GAGCCTAAACACCCCTTAAATTGG -3'
Posted OnJun 08, 2016