Incidental Mutation 'IGL02837:Prl8a1'
ID391932
Institutional Source Beutler Lab
Gene Symbol Prl8a1
Ensembl Gene ENSMUSG00000019756
Gene Nameprolactin family 8, subfamily a, member 1
Synonyms3830403L08Rik, 1600017L04Rik, Plpcd, PLP-Cd, Prlpc4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #IGL02837 (G1)
Quality Score156
Status Validated
Chromosome13
Chromosomal Location27573922-27582171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27575634 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 140 (L140P)
Ref Sequence ENSEMBL: ENSMUSP00000093616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006664] [ENSMUST00000095926]
Predicted Effect probably damaging
Transcript: ENSMUST00000006664
AA Change: L140P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006664
Gene: ENSMUSG00000019756
AA Change: L140P

DomainStartEndE-ValueType
Pfam:Hormone_1 16 240 7.2e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095926
AA Change: L140P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093616
Gene: ENSMUSG00000019756
AA Change: L140P

DomainStartEndE-ValueType
Pfam:Hormone_1 16 193 1e-39 PFAM
Meta Mutation Damage Score 0.382 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,957,581 V786I probably benign Het
Adamts13 A G 2: 26,991,420 N803S probably benign Het
Ago4 C G 4: 126,497,300 G730R possibly damaging Het
Amn T A 12: 111,271,899 M55K possibly damaging Het
Apob A T 12: 8,005,102 Y1334F probably damaging Het
Arl14ep A C 2: 106,969,229 L89R probably damaging Het
Bcam T G 7: 19,764,186 E304A probably damaging Het
Car10 A T 11: 93,597,251 Y258F probably damaging Het
Cerk T A 15: 86,144,695 K82* probably null Het
Chac2 T C 11: 30,977,496 N141S probably damaging Het
Clpx T G 9: 65,324,259 L556R probably damaging Het
Csgalnact2 T C 6: 118,124,403 I55V probably benign Het
Cul1 T C 6: 47,523,205 V650A probably benign Het
Dnah5 A T 15: 28,269,400 E895D probably benign Het
Dnah9 T C 11: 65,874,196 K3841E probably damaging Het
Dpys A G 15: 39,857,305 S20P probably damaging Het
Fat1 G A 8: 45,017,434 V1490I probably benign Het
Flg2 T G 3: 93,201,737 C357W probably damaging Het
Flt1 T A 5: 147,655,170 D494V probably benign Het
Fpr-rs4 T A 17: 18,022,251 D173E probably benign Het
Gm2666 G T 1: 85,485,103 noncoding transcript Het
Gm3867 C A 9: 36,257,800 noncoding transcript Het
Gm5436 A T 12: 84,258,600 noncoding transcript Het
Kit G A 5: 75,639,008 V467I probably benign Het
Krtap4-16 A G 11: 99,851,037 V179A unknown Het
Lrp8 C A 4: 107,861,281 H693Q probably benign Het
Lrrc49 A G 9: 60,610,322 S75P probably benign Het
Ltbp4 C A 7: 27,314,381 V1068L probably damaging Het
Magel2 C T 7: 62,378,260 P304L possibly damaging Het
Muc19 T A 15: 91,882,656 noncoding transcript Het
Npas3 T C 12: 53,947,197 V175A possibly damaging Het
Nr1h4 A T 10: 89,516,480 H8Q probably benign Het
Ntsr2 G A 12: 16,653,875 V126M probably damaging Het
Odf2 A T 2: 29,926,713 T725S probably damaging Het
Olfr12 T C 1: 92,620,682 Y259H possibly damaging Het
Olfr183 C T 16: 59,000,546 P287L probably damaging Het
Olfr603 C T 7: 103,383,615 C129Y probably damaging Het
Pgr T C 9: 8,946,638 probably benign Het
Pik3c2g T A 6: 139,626,564 C249* probably null Het
Plcd3 C T 11: 103,071,103 V726M possibly damaging Het
Prpf6 C A 2: 181,622,263 D239E probably damaging Het
Rcc1 C T 4: 132,337,756 R139H probably benign Het
Rimbp2 G T 5: 128,797,745 Q268K probably damaging Het
Rps19-ps13 A T 18: 40,726,394 noncoding transcript Het
Sema4c C A 1: 36,552,884 G266V probably damaging Het
Sema4g T C 19: 44,996,711 F156S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Speer4f1 G T 5: 17,480,383 L225F unknown Het
Thrap3 T C 4: 126,165,364 probably benign Het
Tnfrsf8 T C 4: 145,268,998 E497G probably benign Het
Trim3 T C 7: 105,612,656 N631S probably damaging Het
Trim45 C T 3: 100,931,627 probably benign Het
Wdr43 A G 17: 71,642,736 D445G probably benign Het
Other mutations in Prl8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02259:Prl8a1 APN 13 27582106 missense probably benign 0.23
IGL02369:Prl8a1 APN 13 27576941 missense possibly damaging 0.58
IGL03257:Prl8a1 APN 13 27575673 missense probably damaging 1.00
R0838:Prl8a1 UTSW 13 27574025 missense probably damaging 1.00
R1480:Prl8a1 UTSW 13 27574072 missense possibly damaging 0.84
R1973:Prl8a1 UTSW 13 27576934 missense probably benign 0.07
R2352:Prl8a1 UTSW 13 27575589 missense probably damaging 1.00
R2396:Prl8a1 UTSW 13 27574024 missense probably benign 0.00
R3732:Prl8a1 UTSW 13 27579733 missense probably damaging 0.98
R3874:Prl8a1 UTSW 13 27575458 missense possibly damaging 0.53
R4895:Prl8a1 UTSW 13 27575530 missense probably benign 0.20
R5135:Prl8a1 UTSW 13 27579819 splice site probably null
R5139:Prl8a1 UTSW 13 27574066 missense probably damaging 0.98
R5908:Prl8a1 UTSW 13 27574057 missense probably benign 0.00
R6232:Prl8a1 UTSW 13 27575574 missense possibly damaging 0.86
R6262:Prl8a1 UTSW 13 27574143 missense possibly damaging 0.95
R7203:Prl8a1 UTSW 13 27574189 missense probably damaging 0.99
R7243:Prl8a1 UTSW 13 27582103 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATGATTGTCCACAAAACCAG -3'
(R):5'- AACATGTGCCATATATGCACAG -3'

Sequencing Primer
(F):5'- TGTTTCACTATGGAAAGATGATGC -3'
(R):5'- CAGTTCAGCTCTTTCATATG -3'
Posted On2016-06-08