Incidental Mutation 'IGL02837:Muc19'
ID 391936
Institutional Source Beutler Lab
Gene Symbol Muc19
Ensembl Gene ENSMUSG00000044021
Gene Name mucin 19
Synonyms sld, apomucin
Accession Numbers
Essential gene? Probably non essential (E-score: 0.182) question?
Stock # IGL02837 (G1)
Quality Score 184
Status Validated
Chromosome 15
Chromosomal Location 91722531-91832440 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) T to A at 91766850 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160242
SMART Domains Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 21 34 N/A INTRINSIC
VWD 47 198 1.31e-13 SMART
Pfam:C8 221 293 1.1e-8 PFAM
Pfam:TIL 298 353 1.6e-11 PFAM
VWD 383 545 1.58e-25 SMART
C8 577 651 8.71e-20 SMART
Pfam:TIL 654 711 2.1e-7 PFAM
Pfam:TIL 753 813 5.2e-8 PFAM
VWD 842 1005 2.36e-47 SMART
C8 1041 1115 1.84e-27 SMART
low complexity region 1220 1254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178108
SMART Domains Protein: ENSMUSP00000136475
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
VWD 30 181 1.31e-13 SMART
Pfam:C8 200 277 2.5e-8 PFAM
Pfam:TIL 281 336 7.5e-12 PFAM
Pfam:VWD 377 477 4.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180042
SMART Domains Protein: ENSMUSP00000136207
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
C8 17 91 8.71e-20 SMART
Pfam:TIL 94 151 1.2e-7 PFAM
Pfam:TIL 193 253 6.6e-8 PFAM
VWD 282 445 2.36e-47 SMART
C8 481 555 1.84e-27 SMART
low complexity region 660 701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for this spontaneous mutation show a partially arrested mucous cell differentiation of the sublingual glands. Severe inflammatory lesions resembling Sjogren's syndrome develop spontaneously in salivary and lacrimal glands of neonatally thymectomized mutants without any immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 36,268,473 (GRCm39) V786I probably benign Het
Adamts13 A G 2: 26,881,432 (GRCm39) N803S probably benign Het
Ago4 C G 4: 126,391,093 (GRCm39) G730R possibly damaging Het
Amn T A 12: 111,238,333 (GRCm39) M55K possibly damaging Het
Apob A T 12: 8,055,102 (GRCm39) Y1334F probably damaging Het
Arl14ep A C 2: 106,799,574 (GRCm39) L89R probably damaging Het
Bcam T G 7: 19,498,111 (GRCm39) E304A probably damaging Het
Car10 A T 11: 93,488,077 (GRCm39) Y258F probably damaging Het
Cerk T A 15: 86,028,896 (GRCm39) K82* probably null Het
Chac2 T C 11: 30,927,496 (GRCm39) N141S probably damaging Het
Clpx T G 9: 65,231,541 (GRCm39) L556R probably damaging Het
Csgalnact2 T C 6: 118,101,364 (GRCm39) I55V probably benign Het
Cul1 T C 6: 47,500,139 (GRCm39) V650A probably benign Het
Dnah5 A T 15: 28,269,546 (GRCm39) E895D probably benign Het
Dnah9 T C 11: 65,765,022 (GRCm39) K3841E probably damaging Het
Dpys A G 15: 39,720,701 (GRCm39) S20P probably damaging Het
Fat1 G A 8: 45,470,471 (GRCm39) V1490I probably benign Het
Flg2 T G 3: 93,109,044 (GRCm39) C357W probably damaging Het
Flt1 T A 5: 147,591,980 (GRCm39) D494V probably benign Het
Fpr-rs4 T A 17: 18,242,513 (GRCm39) D173E probably benign Het
Gm2666 G T 1: 85,412,824 (GRCm39) noncoding transcript Het
Gm3867 C A 9: 36,169,096 (GRCm39) noncoding transcript Het
Gm5436 A T 12: 84,305,374 (GRCm39) noncoding transcript Het
Kit G A 5: 75,799,668 (GRCm39) V467I probably benign Het
Krtap4-16 A G 11: 99,741,863 (GRCm39) V179A unknown Het
Lrp8 C A 4: 107,718,478 (GRCm39) H693Q probably benign Het
Lrrc49 A G 9: 60,517,605 (GRCm39) S75P probably benign Het
Ltbp4 C A 7: 27,013,806 (GRCm39) V1068L probably damaging Het
Magel2 C T 7: 62,028,008 (GRCm39) P304L possibly damaging Het
Npas3 T C 12: 53,993,980 (GRCm39) V175A possibly damaging Het
Nr1h4 A T 10: 89,352,342 (GRCm39) H8Q probably benign Het
Ntsr2 G A 12: 16,703,876 (GRCm39) V126M probably damaging Het
Odf2 A T 2: 29,816,725 (GRCm39) T725S probably damaging Het
Or52e19b C T 7: 103,032,822 (GRCm39) C129Y probably damaging Het
Or5h17 C T 16: 58,820,909 (GRCm39) P287L probably damaging Het
Or9s13 T C 1: 92,548,404 (GRCm39) Y259H possibly damaging Het
Pgr T C 9: 8,946,639 (GRCm39) probably benign Het
Pik3c2g T A 6: 139,603,562 (GRCm39) C249* probably null Het
Plcd3 C T 11: 102,961,929 (GRCm39) V726M possibly damaging Het
Prl8a1 A G 13: 27,759,617 (GRCm39) L140P probably damaging Het
Prpf6 C A 2: 181,264,056 (GRCm39) D239E probably damaging Het
Rcc1 C T 4: 132,065,067 (GRCm39) R139H probably benign Het
Rimbp2 G T 5: 128,874,809 (GRCm39) Q268K probably damaging Het
Rps19-ps13 A T 18: 40,859,447 (GRCm39) noncoding transcript Het
Sema4c C A 1: 36,591,965 (GRCm39) G266V probably damaging Het
Sema4g T C 19: 44,985,150 (GRCm39) F156S probably damaging Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Speer4f1 G T 5: 17,685,381 (GRCm39) L225F unknown Het
Thrap3 T C 4: 126,059,157 (GRCm39) probably benign Het
Tnfrsf8 T C 4: 144,995,568 (GRCm39) E497G probably benign Het
Trim3 T C 7: 105,261,863 (GRCm39) N631S probably damaging Het
Trim45 C T 3: 100,838,943 (GRCm39) probably benign Het
Wdr43 A G 17: 71,949,731 (GRCm39) D445G probably benign Het
Other mutations in Muc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Muc19 APN 15 91,770,943 (GRCm39) exon noncoding transcript
IGL01017:Muc19 APN 15 91,764,901 (GRCm39) exon noncoding transcript
IGL01140:Muc19 APN 15 91,783,593 (GRCm39) exon noncoding transcript
IGL01292:Muc19 APN 15 91,778,470 (GRCm39) exon noncoding transcript
IGL01397:Muc19 APN 15 91,778,498 (GRCm39) exon noncoding transcript
IGL01525:Muc19 APN 15 91,770,877 (GRCm39) exon noncoding transcript
IGL01589:Muc19 APN 15 91,754,699 (GRCm39) exon noncoding transcript
IGL02023:Muc19 APN 15 91,772,453 (GRCm39) exon noncoding transcript
IGL02088:Muc19 APN 15 91,775,362 (GRCm39) splice site noncoding transcript
IGL02168:Muc19 APN 15 91,778,292 (GRCm39) exon noncoding transcript
IGL02343:Muc19 APN 15 91,778,428 (GRCm39) exon noncoding transcript
IGL02402:Muc19 APN 15 91,778,192 (GRCm39) splice site noncoding transcript
IGL02433:Muc19 APN 15 91,756,694 (GRCm39) exon noncoding transcript
IGL02533:Muc19 APN 15 91,782,241 (GRCm39) exon noncoding transcript
IGL02558:Muc19 APN 15 91,781,816 (GRCm39) exon noncoding transcript
IGL02652:Muc19 APN 15 91,762,009 (GRCm39) critical splice donor site noncoding transcript
IGL03032:Muc19 APN 15 91,808,424 (GRCm39) unclassified noncoding transcript
R0098:Muc19 UTSW 15 91,777,101 (GRCm39) exon noncoding transcript
R0098:Muc19 UTSW 15 91,777,101 (GRCm39) exon noncoding transcript
R0208:Muc19 UTSW 15 91,777,218 (GRCm39) splice site noncoding transcript
R0597:Muc19 UTSW 15 91,784,696 (GRCm39) splice site noncoding transcript
R1185:Muc19 UTSW 15 91,762,743 (GRCm39) exon noncoding transcript
R1185:Muc19 UTSW 15 91,762,743 (GRCm39) exon noncoding transcript
R1469:Muc19 UTSW 15 91,758,498 (GRCm39) unclassified noncoding transcript
R1942:Muc19 UTSW 15 91,776,666 (GRCm39) exon noncoding transcript
R2035:Muc19 UTSW 15 91,776,599 (GRCm39) splice site noncoding transcript
R2208:Muc19 UTSW 15 91,755,747 (GRCm39) exon noncoding transcript
R2877:Muc19 UTSW 15 91,777,200 (GRCm39) exon noncoding transcript
R2897:Muc19 UTSW 15 91,822,550 (GRCm39) critical splice donor site noncoding transcript
R4110:Muc19 UTSW 15 91,781,816 (GRCm39) exon noncoding transcript
R4403:Muc19 UTSW 15 91,755,768 (GRCm39) exon noncoding transcript
R4606:Muc19 UTSW 15 91,832,268 (GRCm39) exon noncoding transcript
R4677:Muc19 UTSW 15 91,772,411 (GRCm39) exon noncoding transcript
R4753:Muc19 UTSW 15 91,761,955 (GRCm39) unclassified noncoding transcript
R4781:Muc19 UTSW 15 91,787,360 (GRCm39) critical splice donor site noncoding transcript
R4869:Muc19 UTSW 15 91,781,910 (GRCm39) exon noncoding transcript
R5000:Muc19 UTSW 15 91,757,429 (GRCm39) unclassified noncoding transcript
R5044:Muc19 UTSW 15 91,772,332 (GRCm39) exon noncoding transcript
R5156:Muc19 UTSW 15 91,784,614 (GRCm39) exon noncoding transcript
R5176:Muc19 UTSW 15 91,776,374 (GRCm39) exon noncoding transcript
R5224:Muc19 UTSW 15 91,825,910 (GRCm39) exon noncoding transcript
R5524:Muc19 UTSW 15 91,778,587 (GRCm39) exon noncoding transcript
R5568:Muc19 UTSW 15 91,768,468 (GRCm39) splice site noncoding transcript
R5592:Muc19 UTSW 15 91,828,199 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TAAAGTGCTTGTCTGCTCCTG -3'
(R):5'- TATAAGCTGGCCATCACCCC -3'

Sequencing Primer
(F):5'- GTGGGTACACTGGATGAAGCTTC -3'
(R):5'- AGCTTATCCCAGTGAGACAGGTTC -3'
Posted On 2016-06-08