Mutagenetix > Incidental Mutation

Incidental Mutation 'R0442:Rp1'

39197

Institutional Source

Beutler Lab

Gene Symbol

Rp1

Ensembl Gene

ENSMUSG00000025900

Gene Name

retinitis pigmentosa 1 (human)

Synonyms

Dcdc3, Orp1, mG145, Rp1h, oxygen-regulated protein 1

MMRRC Submission

038643-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R0442 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4185896-4479508 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 4416970 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1381 (D1381N)

Ref Sequence

ENSEMBL: ENSMUSP00000027032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]

AlphaFold

P56716

Predicted Effect

probably benign
Transcript: ENSMUST00000027032
AA Change: D1381N

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: D1381N

Domain	Start	End	E-Value	Type
DCX	30	117	4.37e-39	SMART
low complexity region	120	133	N/A	INTRINSIC
DCX	152	236	7.17e-35	SMART
low complexity region	343	354	N/A	INTRINSIC
low complexity region	403	414	N/A	INTRINSIC
low complexity region	462	473	N/A	INTRINSIC
low complexity region	646	661	N/A	INTRINSIC
low complexity region	1113	1123	N/A	INTRINSIC
low complexity region	1396	1412	N/A	INTRINSIC
low complexity region	1434	1444	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194992

SMART Domains

Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

Domain	Start	End	E-Value	Type
DCX	40	127	4.37e-39	SMART
low complexity region	130	143	N/A	INTRINSIC
DCX	162	246	7.17e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000208660

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208793

Meta Mutation Damage Score

0.0992

Coding Region Coverage

1x: 98.8%
3x: 97.5%
10x: 93.4%
20x: 81.2%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	T	A	1: 25,435,551 (GRCm39)	N816Y	probably damaging	Het
Arfgef3	T	C	10: 18,553,563 (GRCm39)		probably benign	Het
Cd200	T	A	16: 45,217,518 (GRCm39)	S58C	probably damaging	Het
Cep128	C	T	12: 91,233,545 (GRCm39)	E508K	probably damaging	Het
Dnah2	C	A	11: 69,339,368 (GRCm39)	L3046F	probably damaging	Het
Duox2	T	C	2: 122,119,813 (GRCm39)	N872D	probably benign	Het
Fam90a1a	C	T	8: 22,453,074 (GRCm39)	T143I	probably benign	Het
Fdft1	T	C	14: 63,400,798 (GRCm39)	T112A	probably benign	Het
Gimap9	G	T	6: 48,655,000 (GRCm39)	G196*	probably null	Het
Grhl1	G	A	12: 24,662,169 (GRCm39)	R536Q	probably damaging	Het
Gtpbp3	T	A	8: 71,944,135 (GRCm39)	V293E	probably damaging	Het
Hcn3	A	T	3: 89,058,847 (GRCm39)	F251Y	probably damaging	Het
Hectd4	T	A	5: 121,462,045 (GRCm39)	C971S	possibly damaging	Het
Helz2	T	A	2: 180,874,002 (GRCm39)	D2164V	probably damaging	Het
Hif1an	T	G	19: 44,554,451 (GRCm39)	L188R	probably damaging	Het
Hjurp	GT	GTT	1: 88,194,246 (GRCm39)		probably null	Het
Iqgap3	C	T	3: 88,023,266 (GRCm39)	P519L	probably damaging	Het
Jakmip1	T	G	5: 37,292,897 (GRCm39)		probably null	Het
Klra1	T	C	6: 130,349,835 (GRCm39)	Y201C	probably damaging	Het
Minpp1	T	C	19: 32,471,348 (GRCm39)	F299L	possibly damaging	Het
Myb	A	G	10: 21,002,095 (GRCm39)	S749P	probably benign	Het
Myo3b	T	C	2: 70,069,305 (GRCm39)		probably null	Het
Naip1	T	A	13: 100,581,024 (GRCm39)	R74S	probably benign	Het
Nt5m	A	G	11: 59,765,445 (GRCm39)	T158A	possibly damaging	Het
Obscn	A	T	11: 58,893,000 (GRCm39)		probably benign	Het
Or5af1	T	A	11: 58,722,257 (GRCm39)	Y92*	probably null	Het
Or5b119	T	G	19: 13,457,412 (GRCm39)	D50A	probably damaging	Het
Or6c210	T	C	10: 129,495,693 (GRCm39)	I6T	probably benign	Het
Otogl	T	A	10: 107,712,716 (GRCm39)	T543S	probably damaging	Het
Pds5b	T	C	5: 150,640,009 (GRCm39)		probably benign	Het
Plekhm1	A	G	11: 103,288,000 (GRCm39)	M49T	possibly damaging	Het
Rabl6	A	T	2: 25,477,534 (GRCm39)	S305R	probably damaging	Het
Rad54b	G	A	4: 11,609,480 (GRCm39)		probably benign	Het
Rad54b	C	A	4: 11,610,362 (GRCm39)	R660S	probably benign	Het
Rexo5	T	C	7: 119,442,508 (GRCm39)	L542P	probably damaging	Het
Scnn1a	T	G	6: 125,316,100 (GRCm39)	M346R	probably damaging	Het
Sirpb1c	A	G	3: 15,856,710 (GRCm39)	I380T	probably benign	Het
Snrnp40	C	G	4: 130,271,836 (GRCm39)		probably null	Het
Sstr3	A	T	15: 78,424,597 (GRCm39)	L50Q	probably damaging	Het
St3gal6	C	A	16: 58,293,816 (GRCm39)	A238S	probably damaging	Het
St3gal6	G	T	16: 58,293,818 (GRCm39)	A237E	probably damaging	Het
Sun5	T	C	2: 153,712,872 (GRCm39)	D16G	possibly damaging	Het
Svil	A	T	18: 5,046,870 (GRCm39)	T39S	probably damaging	Het
Taar1	A	G	10: 23,796,380 (GRCm39)	Y26C	possibly damaging	Het
Ugt1a1	AT	A	1: 88,140,093 (GRCm39)		probably null	Het
Use1	T	C	8: 71,819,702 (GRCm39)		probably benign	Het
Usp54	T	C	14: 20,657,277 (GRCm39)	Y7C	probably damaging	Het
Zbtb37	A	G	1: 160,859,918 (GRCm39)	F129S	possibly damaging	Het
Zfhx2	T	C	14: 55,304,357 (GRCm39)	H1209R	possibly damaging	Het
Zfp28	T	C	7: 6,397,998 (GRCm39)	L811P	probably damaging	Het
Zfp616	T	C	11: 73,975,321 (GRCm39)	I530T	possibly damaging	Het

Other mutations in Rp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Rp1	APN	1	4,416,969 (GRCm39)	missense	probably damaging	0.98
IGL00593:Rp1	APN	1	4,415,626 (GRCm39)	missense	possibly damaging	0.70
IGL00956:Rp1	APN	1	4,422,435 (GRCm39)	missense	probably damaging	1.00
IGL01070:Rp1	APN	1	4,415,461 (GRCm39)	missense	probably damaging	1.00
IGL01531:Rp1	APN	1	4,419,168 (GRCm39)	missense	probably benign	0.00
IGL01668:Rp1	APN	1	4,415,941 (GRCm39)	missense	probably damaging	1.00
IGL01907:Rp1	APN	1	4,418,730 (GRCm39)	missense	possibly damaging	0.56
IGL02055:Rp1	APN	1	4,422,745 (GRCm39)	missense	probably damaging	1.00
IGL02071:Rp1	APN	1	4,415,533 (GRCm39)	missense	possibly damaging	0.46
IGL02128:Rp1	APN	1	4,417,608 (GRCm39)	missense	probably damaging	0.99
IGL02244:Rp1	APN	1	4,419,003 (GRCm39)	missense	probably benign	0.00
IGL02381:Rp1	APN	1	4,422,613 (GRCm39)	missense	probably benign	0.01
IGL02499:Rp1	APN	1	4,419,271 (GRCm39)	missense	probably benign	0.17
IGL02619:Rp1	APN	1	4,418,673 (GRCm39)	missense	possibly damaging	0.73
IGL02832:Rp1	APN	1	4,419,936 (GRCm39)	missense	probably benign	0.03
IGL02861:Rp1	APN	1	4,416,375 (GRCm39)	nonsense	probably null
IGL03288:Rp1	APN	1	4,419,747 (GRCm39)	missense	possibly damaging	0.88
IGL03290:Rp1	APN	1	4,420,264 (GRCm39)	missense	probably damaging	1.00
IGL03303:Rp1	APN	1	4,415,040 (GRCm39)	missense	probably damaging	1.00
R0041:Rp1	UTSW	1	4,414,851 (GRCm39)	missense	probably benign	0.36
R0111:Rp1	UTSW	1	4,414,983 (GRCm39)	missense	probably damaging	1.00
R0363:Rp1	UTSW	1	4,417,941 (GRCm39)	missense	probably damaging	1.00
R0440:Rp1	UTSW	1	4,415,863 (GRCm39)	missense	probably damaging	1.00
R0528:Rp1	UTSW	1	4,415,088 (GRCm39)	missense	possibly damaging	0.82
R0586:Rp1	UTSW	1	4,418,060 (GRCm39)	missense	possibly damaging	0.76
R0639:Rp1	UTSW	1	4,416,721 (GRCm39)	missense	probably benign	0.00
R0856:Rp1	UTSW	1	4,414,878 (GRCm39)	missense	probably benign	0.05
R0908:Rp1	UTSW	1	4,414,878 (GRCm39)	missense	probably benign	0.05
R0968:Rp1	UTSW	1	4,415,575 (GRCm39)	missense	probably benign	0.00
R1099:Rp1	UTSW	1	4,422,513 (GRCm39)	missense	possibly damaging	0.45
R1242:Rp1	UTSW	1	4,415,185 (GRCm39)	missense	probably benign	0.03
R1301:Rp1	UTSW	1	4,416,159 (GRCm39)	missense	possibly damaging	0.56
R1327:Rp1	UTSW	1	4,418,193 (GRCm39)	missense	probably benign	0.01
R1403:Rp1	UTSW	1	4,416,520 (GRCm39)	missense	possibly damaging	0.73
R1403:Rp1	UTSW	1	4,416,520 (GRCm39)	missense	possibly damaging	0.73
R1406:Rp1	UTSW	1	4,422,144 (GRCm39)	missense	possibly damaging	0.88
R1406:Rp1	UTSW	1	4,422,144 (GRCm39)	missense	possibly damaging	0.88
R1440:Rp1	UTSW	1	4,417,619 (GRCm39)	missense	probably damaging	1.00
R1509:Rp1	UTSW	1	4,417,917 (GRCm39)	missense	probably damaging	0.98
R1509:Rp1	UTSW	1	4,418,760 (GRCm39)	missense	probably benign	0.20
R1538:Rp1	UTSW	1	4,415,899 (GRCm39)	missense	probably damaging	1.00
R1609:Rp1	UTSW	1	4,419,424 (GRCm39)	missense	probably damaging	1.00
R1666:Rp1	UTSW	1	4,420,086 (GRCm39)	missense	probably damaging	1.00
R1703:Rp1	UTSW	1	4,415,392 (GRCm39)	missense	probably damaging	1.00
R1782:Rp1	UTSW	1	4,419,312 (GRCm39)	missense	probably benign	0.00
R1799:Rp1	UTSW	1	4,419,055 (GRCm39)	missense	possibly damaging	0.94
R1848:Rp1	UTSW	1	4,417,455 (GRCm39)	missense	possibly damaging	0.76
R1908:Rp1	UTSW	1	4,418,943 (GRCm39)	missense	probably damaging	0.99
R1919:Rp1	UTSW	1	4,422,894 (GRCm39)	missense	probably damaging	0.99
R2087:Rp1	UTSW	1	4,418,575 (GRCm39)	missense	probably damaging	1.00
R2211:Rp1	UTSW	1	4,418,362 (GRCm39)	missense	probably damaging	0.96
R2278:Rp1	UTSW	1	4,418,250 (GRCm39)	missense	possibly damaging	0.51
R2287:Rp1	UTSW	1	4,416,182 (GRCm39)	nonsense	probably null
R2316:Rp1	UTSW	1	4,415,863 (GRCm39)	missense	probably damaging	1.00
R2346:Rp1	UTSW	1	4,418,236 (GRCm39)	missense	probably damaging	1.00
R2878:Rp1	UTSW	1	4,418,362 (GRCm39)	missense	probably damaging	1.00
R3023:Rp1	UTSW	1	4,422,898 (GRCm39)	missense	probably damaging	1.00
R3025:Rp1	UTSW	1	4,422,898 (GRCm39)	missense	probably damaging	1.00
R3716:Rp1	UTSW	1	4,419,988 (GRCm39)	missense	probably benign	0.38
R3814:Rp1	UTSW	1	4,419,931 (GRCm39)	missense	probably benign
R3929:Rp1	UTSW	1	4,422,868 (GRCm39)	missense	probably damaging	1.00
R4064:Rp1	UTSW	1	4,415,623 (GRCm39)	missense	probably benign	0.08
R4426:Rp1	UTSW	1	4,418,147 (GRCm39)	missense	probably benign	0.13
R4557:Rp1	UTSW	1	4,414,886 (GRCm39)	missense	possibly damaging	0.61
R4764:Rp1	UTSW	1	4,416,101 (GRCm39)	missense	probably damaging	0.96
R4845:Rp1	UTSW	1	4,419,451 (GRCm39)	missense	probably benign	0.02
R4850:Rp1	UTSW	1	4,418,898 (GRCm39)	missense	probably damaging	1.00
R4857:Rp1	UTSW	1	4,422,540 (GRCm39)	missense	probably damaging	1.00
R4857:Rp1	UTSW	1	4,422,539 (GRCm39)	missense	probably damaging	0.99
R5159:Rp1	UTSW	1	4,416,426 (GRCm39)	missense	possibly damaging	0.73
R5226:Rp1	UTSW	1	4,418,256 (GRCm39)	missense	probably benign	0.01
R5327:Rp1	UTSW	1	4,419,583 (GRCm39)	splice site	probably null
R5352:Rp1	UTSW	1	4,417,321 (GRCm39)	missense	probably benign	0.00
R5504:Rp1	UTSW	1	4,420,113 (GRCm39)	missense	probably damaging	1.00
R5527:Rp1	UTSW	1	4,416,616 (GRCm39)	missense	possibly damaging	0.75
R5529:Rp1	UTSW	1	4,416,055 (GRCm39)	missense	probably benign	0.42
R5569:Rp1	UTSW	1	4,415,460 (GRCm39)	missense	probably damaging	1.00
R5622:Rp1	UTSW	1	4,418,060 (GRCm39)	missense	possibly damaging	0.76
R5970:Rp1	UTSW	1	4,418,685 (GRCm39)	missense	probably benign	0.05
R5992:Rp1	UTSW	1	4,218,926 (GRCm39)	missense	unknown
R6004:Rp1	UTSW	1	4,267,808 (GRCm39)	missense	unknown
R6018:Rp1	UTSW	1	4,423,059 (GRCm39)	missense	possibly damaging	0.83
R6074:Rp1	UTSW	1	4,415,602 (GRCm39)	missense	probably benign	0.02
R6127:Rp1	UTSW	1	4,419,534 (GRCm39)	missense	possibly damaging	0.80
R6187:Rp1	UTSW	1	4,420,092 (GRCm39)	missense	probably damaging	1.00
R6301:Rp1	UTSW	1	4,417,477 (GRCm39)	missense	probably benign	0.04
R6317:Rp1	UTSW	1	4,112,212 (GRCm39)	missense	unknown
R6405:Rp1	UTSW	1	4,415,994 (GRCm39)	missense	probably damaging	1.00
R6445:Rp1	UTSW	1	4,296,840 (GRCm39)	missense	unknown
R6466:Rp1	UTSW	1	4,418,109 (GRCm39)	missense	probably benign	0.01
R6501:Rp1	UTSW	1	4,381,503 (GRCm39)	intron	probably benign
R6547:Rp1	UTSW	1	4,240,528 (GRCm39)	missense	unknown
R6604:Rp1	UTSW	1	4,089,351 (GRCm39)	missense	unknown
R6700:Rp1	UTSW	1	4,420,119 (GRCm39)	missense	probably damaging	1.00
R6706:Rp1	UTSW	1	4,212,887 (GRCm39)	missense	unknown
R6831:Rp1	UTSW	1	4,420,087 (GRCm39)	splice site	probably null
R6918:Rp1	UTSW	1	4,069,831 (GRCm39)	missense	unknown
R6973:Rp1	UTSW	1	4,422,217 (GRCm39)	nonsense	probably null
R6981:Rp1	UTSW	1	4,415,878 (GRCm39)	missense	probably benign	0.06
R7009:Rp1	UTSW	1	4,112,291 (GRCm39)	missense	unknown
R7078:Rp1	UTSW	1	4,277,014 (GRCm39)	missense	unknown
R7112:Rp1	UTSW	1	4,419,241 (GRCm39)	missense	probably benign	0.43
R7135:Rp1	UTSW	1	4,418,391 (GRCm39)	missense	possibly damaging	0.83
R7165:Rp1	UTSW	1	4,420,140 (GRCm39)	missense	probably damaging	0.99
R7199:Rp1	UTSW	1	4,417,513 (GRCm39)	missense	possibly damaging	0.73
R7232:Rp1	UTSW	1	4,298,824 (GRCm39)	missense	unknown
R7367:Rp1	UTSW	1	4,418,221 (GRCm39)	missense	probably benign	0.42
R7484:Rp1	UTSW	1	4,415,704 (GRCm39)	missense	probably benign	0.10
R7500:Rp1	UTSW	1	4,381,501 (GRCm39)	missense	unknown
R7569:Rp1	UTSW	1	4,355,063 (GRCm39)	missense	unknown
R7642:Rp1	UTSW	1	4,218,054 (GRCm39)	missense	unknown
R7693:Rp1	UTSW	1	4,417,626 (GRCm39)	missense	probably damaging	1.00
R7742:Rp1	UTSW	1	4,240,457 (GRCm39)	missense	unknown
R7759:Rp1	UTSW	1	4,415,107 (GRCm39)	missense	probably benign
R7784:Rp1	UTSW	1	4,212,881 (GRCm39)	missense	unknown
R7816:Rp1	UTSW	1	4,417,926 (GRCm39)	missense	probably damaging	0.98
R7866:Rp1	UTSW	1	4,417,924 (GRCm39)	missense	probably benign	0.02
R8215:Rp1	UTSW	1	4,315,318 (GRCm39)	missense	unknown
R8281:Rp1	UTSW	1	4,418,139 (GRCm39)	missense	probably damaging	1.00
R8294:Rp1	UTSW	1	4,416,220 (GRCm39)	missense	probably benign	0.09
R8309:Rp1	UTSW	1	4,417,312 (GRCm39)	missense	probably benign	0.00
R8311:Rp1	UTSW	1	4,418,572 (GRCm39)	missense	probably benign	0.11
R8500:Rp1	UTSW	1	4,416,813 (GRCm39)	missense	possibly damaging	0.91
R8559:Rp1	UTSW	1	4,419,784 (GRCm39)	missense	probably damaging	1.00
R8672:Rp1	UTSW	1	4,419,007 (GRCm39)	missense	possibly damaging	0.55
R8688:Rp1	UTSW	1	4,416,628 (GRCm39)	missense	probably benign	0.01
R8792:Rp1	UTSW	1	4,095,091 (GRCm39)	missense	unknown
R8859:Rp1	UTSW	1	4,420,183 (GRCm39)	missense	probably benign	0.07
R8945:Rp1	UTSW	1	4,419,817 (GRCm39)	missense	probably benign	0.42
R8959:Rp1	UTSW	1	4,419,650 (GRCm39)	intron	probably benign
R8979:Rp1	UTSW	1	4,218,937 (GRCm39)	missense	unknown
R9126:Rp1	UTSW	1	4,417,136 (GRCm39)	missense	probably damaging	0.99
R9156:Rp1	UTSW	1	4,234,161 (GRCm39)	missense	unknown
R9160:Rp1	UTSW	1	4,416,720 (GRCm39)	missense	probably benign	0.00
R9221:Rp1	UTSW	1	4,315,266 (GRCm39)	missense	unknown
R9263:Rp1	UTSW	1	4,419,160 (GRCm39)	missense	probably benign	0.02
R9263:Rp1	UTSW	1	4,418,675 (GRCm39)	missense	probably benign	0.25
R9302:Rp1	UTSW	1	4,416,789 (GRCm39)	missense	probably damaging	1.00
R9318:Rp1	UTSW	1	4,418,488 (GRCm39)	missense	probably benign	0.09
R9414:Rp1	UTSW	1	4,313,841 (GRCm39)	missense	unknown
R9474:Rp1	UTSW	1	4,162,838 (GRCm39)	critical splice donor site	probably null
R9478:Rp1	UTSW	1	4,417,545 (GRCm39)	missense	probably benign	0.06
R9529:Rp1	UTSW	1	4,416,447 (GRCm39)	missense	probably benign
R9572:Rp1	UTSW	1	4,418,662 (GRCm39)	missense	probably benign
R9673:Rp1	UTSW	1	4,337,792 (GRCm39)	missense	unknown
R9709:Rp1	UTSW	1	4,112,255 (GRCm39)	missense	unknown
R9716:Rp1	UTSW	1	4,212,833 (GRCm39)	critical splice donor site	probably null
RF003:Rp1	UTSW	1	4,414,917 (GRCm39)	missense	probably damaging	0.99
V1662:Rp1	UTSW	1	4,419,783 (GRCm39)	missense	probably damaging	1.00
X0012:Rp1	UTSW	1	4,417,918 (GRCm39)	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CGGTTGTCTCCAGAATGGCAGTATTTC -3'
(R):5'- TCTATGAGGGAGCTTGCCTAAGTGATG -3'

Sequencing Primer
(F):5'- GAACTCATCCTAGCCTCTGATTG -3'
(R):5'- AGCTTGCCTAAGTGATGAGACTC -3'

Posted On

2013-05-23