Incidental Mutation 'IGL02796:Tbc1d5'
ID392046
Institutional Source Beutler Lab
Gene Symbol Tbc1d5
Ensembl Gene ENSMUSG00000023923
Gene NameTBC1 domain family, member 5
Synonyms1600014N05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #IGL02796 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location50733124-51179352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 50966624 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 123 (H123Q)
Ref Sequence ENSEMBL: ENSMUSP00000153172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024717] [ENSMUST00000224528]
Predicted Effect probably damaging
Transcript: ENSMUST00000024717
AA Change: H123Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024717
Gene: ENSMUSG00000023923
AA Change: H123Q

DomainStartEndE-ValueType
TBC 78 384 5.56e-86 SMART
low complexity region 475 492 N/A INTRINSIC
SCOP:d1lsha3 511 546 1e-3 SMART
low complexity region 556 568 N/A INTRINSIC
low complexity region 783 802 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224123
Predicted Effect probably damaging
Transcript: ENSMUST00000224528
AA Change: H123Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225252
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 A T 19: 55,278,169 K86* probably null Het
Ambp C A 4: 63,153,932 probably benign Het
Atp6v0d2 A T 4: 19,887,324 M208K probably damaging Het
Brinp1 C G 4: 68,762,190 R701P probably damaging Het
Btnl9 T C 11: 49,169,181 D580G probably damaging Het
Cand1 A T 10: 119,213,638 L401H probably damaging Het
Ccdc66 T C 14: 27,486,566 E577G possibly damaging Het
Ccdc93 C A 1: 121,491,166 D483E probably damaging Het
Cd38 T C 5: 43,906,213 L216P probably damaging Het
Cdr1 C T X: 61,184,481 D360N possibly damaging Het
Col9a3 G T 2: 180,614,162 D443Y probably damaging Het
Cpt1b C T 15: 89,424,802 V66I probably benign Het
Cyp8b1 T A 9: 121,915,498 Y256F probably benign Het
Dync1i1 A G 6: 5,757,385 N48S probably benign Het
Ehd3 T A 17: 73,816,401 L133Q probably damaging Het
Eif6 C A 2: 155,826,148 R57L probably damaging Het
Fam45a A G 19: 60,817,643 probably benign Het
Fam92b C T 8: 120,177,399 probably benign Het
Fcgbp T A 7: 28,101,151 probably benign Het
Fgl1 C T 8: 41,197,058 A229T probably benign Het
Flg2 C T 3: 93,203,613 R983W unknown Het
Gdf7 A T 12: 8,301,666 S90T unknown Het
Ggta1 T C 2: 35,413,317 probably benign Het
Gm44859 C T 19: 12,036,748 probably benign Het
Grin2a T C 16: 9,585,108 E838G possibly damaging Het
Grin2c A G 11: 115,250,717 probably benign Het
Grm1 T C 10: 10,689,667 T966A probably benign Het
Gtpbp1 A G 15: 79,716,985 I468M possibly damaging Het
Gucy1b2 G A 14: 62,407,694 P639S probably benign Het
Hat1 T C 2: 71,420,356 probably null Het
Hira A T 16: 18,925,654 I374F probably benign Het
Htt C A 5: 34,877,482 Q2024K probably benign Het
Kcnj6 A G 16: 94,832,919 M111T probably benign Het
Loxhd1 T A 18: 77,369,115 probably benign Het
Lrif1 T A 3: 106,735,436 M619K probably benign Het
Lrrc8b G A 5: 105,481,345 G519D probably damaging Het
Map3k7 A G 4: 31,979,692 probably benign Het
Olfr1018 T C 2: 85,823,589 I206T probably benign Het
Olfr1428 T A 19: 12,108,884 I221F possibly damaging Het
P2ry12 T C 3: 59,217,881 I124M probably damaging Het
Paxbp1 A G 16: 91,025,294 probably benign Het
Polb A T 8: 22,631,458 I257N probably damaging Het
Psg27 A T 7: 18,561,950 V190E probably benign Het
Rabgap1 T A 2: 37,472,306 N54K probably damaging Het
Sacm1l T A 9: 123,548,924 W90R possibly damaging Het
Snrpb2 A T 2: 143,064,567 M1L probably benign Het
Spata31d1d A G 13: 59,728,243 Y493H possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Spocd1 A G 4: 129,947,755 probably benign Het
Ttn T C 2: 76,778,101 N17826S probably damaging Het
Tubgcp6 A G 15: 89,122,390 I143T probably benign Het
Usp48 A G 4: 137,610,718 Y268C probably damaging Het
Zfhx4 G A 3: 5,399,539 V1586M probably damaging Het
Zfp146 C T 7: 30,162,558 V20I probably benign Het
Zfp263 G A 16: 3,746,876 E252K probably benign Het
Other mutations in Tbc1d5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tbc1d5 APN 17 50813798 missense possibly damaging 0.52
IGL01370:Tbc1d5 APN 17 50966727 missense probably benign 0.18
IGL01625:Tbc1d5 APN 17 50917573 missense probably benign 0.27
IGL01935:Tbc1d5 APN 17 50963765 splice site probably benign
IGL02229:Tbc1d5 APN 17 50852600 missense probably damaging 1.00
IGL02811:Tbc1d5 APN 17 50800121 missense probably damaging 0.99
IGL03192:Tbc1d5 APN 17 50984681 splice site probably benign
FR4976:Tbc1d5 UTSW 17 50799931 missense probably benign
FR4976:Tbc1d5 UTSW 17 50799943 missense probably benign 0.01
R0153:Tbc1d5 UTSW 17 50984687 splice site probably benign
R0326:Tbc1d5 UTSW 17 50966736 missense probably damaging 1.00
R0417:Tbc1d5 UTSW 17 50756705 missense probably benign 0.18
R0481:Tbc1d5 UTSW 17 50919051 missense probably damaging 0.98
R1143:Tbc1d5 UTSW 17 50742059 nonsense probably null
R1533:Tbc1d5 UTSW 17 50920575 missense possibly damaging 0.89
R1543:Tbc1d5 UTSW 17 50935532 missense probably benign 0.32
R2888:Tbc1d5 UTSW 17 50935549 missense probably damaging 1.00
R3153:Tbc1d5 UTSW 17 50968236 missense probably damaging 1.00
R3430:Tbc1d5 UTSW 17 50800128 missense probably damaging 1.00
R3898:Tbc1d5 UTSW 17 50963744 missense probably damaging 0.98
R4116:Tbc1d5 UTSW 17 50920587 missense probably damaging 1.00
R4352:Tbc1d5 UTSW 17 50782401 missense probably damaging 0.98
R4456:Tbc1d5 UTSW 17 50782341 missense probably damaging 1.00
R4648:Tbc1d5 UTSW 17 50736223 missense probably benign
R4711:Tbc1d5 UTSW 17 50935509 missense probably damaging 0.98
R4754:Tbc1d5 UTSW 17 50800165 missense probably benign 0.03
R5303:Tbc1d5 UTSW 17 50736200 missense probably benign 0.00
R5360:Tbc1d5 UTSW 17 50984632 missense probably benign 0.26
R5443:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5444:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5611:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5658:Tbc1d5 UTSW 17 50813841 missense probably benign 0.18
R5701:Tbc1d5 UTSW 17 50799955 small deletion probably benign
R5921:Tbc1d5 UTSW 17 50963693 missense probably damaging 1.00
R6280:Tbc1d5 UTSW 17 50782310 missense probably benign 0.01
R6628:Tbc1d5 UTSW 17 50736208 missense probably benign
R6705:Tbc1d5 UTSW 17 51025175 start gained probably benign
R6990:Tbc1d5 UTSW 17 50968232 missense probably benign 0.19
Z1088:Tbc1d5 UTSW 17 50963696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTGCCCTTTACCCTACAC -3'
(R):5'- TGAGTGAAACATGTTATAAGCTGGG -3'

Sequencing Primer
(F):5'- AGGAAACCTTCAGGCTCTTG -3'
(R):5'- AAGCTGGGTATTTCTCTGAATTTTC -3'
Posted On2016-06-08