Incidental Mutation 'IGL02796:Olfr1428'
ID392049
Institutional Source Beutler Lab
Gene Symbol Olfr1428
Ensembl Gene ENSMUSG00000067524
Gene Nameolfactory receptor 1428
SynonymsGA_x6K02T2RE5P-2468394-2467450, MOR239-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #IGL02796 (G1)
Quality Score157
Status Validated
Chromosome19
Chromosomal Location12107716-12115897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12108884 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 221 (I221F)
Ref Sequence ENSEMBL: ENSMUSP00000150097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087824] [ENSMUST00000208391] [ENSMUST00000214103]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087824
AA Change: I221F

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085126
Gene: ENSMUSG00000067524
AA Change: I221F

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.1e-43 PFAM
Pfam:7TM_GPCR_Srsx 35 305 6.2e-6 PFAM
Pfam:7tm_1 41 303 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208391
Predicted Effect possibly damaging
Transcript: ENSMUST00000214103
AA Change: I221F

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 A T 19: 55,278,169 K86* probably null Het
Ambp C A 4: 63,153,932 probably benign Het
Atp6v0d2 A T 4: 19,887,324 M208K probably damaging Het
Brinp1 C G 4: 68,762,190 R701P probably damaging Het
Btnl9 T C 11: 49,169,181 D580G probably damaging Het
Cand1 A T 10: 119,213,638 L401H probably damaging Het
Ccdc66 T C 14: 27,486,566 E577G possibly damaging Het
Ccdc93 C A 1: 121,491,166 D483E probably damaging Het
Cd38 T C 5: 43,906,213 L216P probably damaging Het
Cdr1 C T X: 61,184,481 D360N possibly damaging Het
Col9a3 G T 2: 180,614,162 D443Y probably damaging Het
Cpt1b C T 15: 89,424,802 V66I probably benign Het
Cyp8b1 T A 9: 121,915,498 Y256F probably benign Het
Dync1i1 A G 6: 5,757,385 N48S probably benign Het
Ehd3 T A 17: 73,816,401 L133Q probably damaging Het
Eif6 C A 2: 155,826,148 R57L probably damaging Het
Fam45a A G 19: 60,817,643 probably benign Het
Fam92b C T 8: 120,177,399 probably benign Het
Fcgbp T A 7: 28,101,151 probably benign Het
Fgl1 C T 8: 41,197,058 A229T probably benign Het
Flg2 C T 3: 93,203,613 R983W unknown Het
Gdf7 A T 12: 8,301,666 S90T unknown Het
Ggta1 T C 2: 35,413,317 probably benign Het
Gm44859 C T 19: 12,036,748 probably benign Het
Grin2a T C 16: 9,585,108 E838G possibly damaging Het
Grin2c A G 11: 115,250,717 probably benign Het
Grm1 T C 10: 10,689,667 T966A probably benign Het
Gtpbp1 A G 15: 79,716,985 I468M possibly damaging Het
Gucy1b2 G A 14: 62,407,694 P639S probably benign Het
Hat1 T C 2: 71,420,356 probably null Het
Hira A T 16: 18,925,654 I374F probably benign Het
Htt C A 5: 34,877,482 Q2024K probably benign Het
Kcnj6 A G 16: 94,832,919 M111T probably benign Het
Loxhd1 T A 18: 77,369,115 probably benign Het
Lrif1 T A 3: 106,735,436 M619K probably benign Het
Lrrc8b G A 5: 105,481,345 G519D probably damaging Het
Map3k7 A G 4: 31,979,692 probably benign Het
Olfr1018 T C 2: 85,823,589 I206T probably benign Het
P2ry12 T C 3: 59,217,881 I124M probably damaging Het
Paxbp1 A G 16: 91,025,294 probably benign Het
Polb A T 8: 22,631,458 I257N probably damaging Het
Psg27 A T 7: 18,561,950 V190E probably benign Het
Rabgap1 T A 2: 37,472,306 N54K probably damaging Het
Sacm1l T A 9: 123,548,924 W90R possibly damaging Het
Snrpb2 A T 2: 143,064,567 M1L probably benign Het
Spata31d1d A G 13: 59,728,243 Y493H possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Spocd1 A G 4: 129,947,755 probably benign Het
Tbc1d5 G T 17: 50,966,624 H123Q probably damaging Het
Ttn T C 2: 76,778,101 N17826S probably damaging Het
Tubgcp6 A G 15: 89,122,390 I143T probably benign Het
Usp48 A G 4: 137,610,718 Y268C probably damaging Het
Zfhx4 G A 3: 5,399,539 V1586M probably damaging Het
Zfp146 C T 7: 30,162,558 V20I probably benign Het
Zfp263 G A 16: 3,746,876 E252K probably benign Het
Other mutations in Olfr1428
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03062:Olfr1428 APN 19 12109148 missense probably benign 0.00
PIT4495001:Olfr1428 UTSW 19 12108712 missense possibly damaging 0.65
R0541:Olfr1428 UTSW 19 12109520 missense possibly damaging 0.85
R1169:Olfr1428 UTSW 19 12109489 missense probably benign
R1918:Olfr1428 UTSW 19 12109507 missense probably benign 0.06
R2915:Olfr1428 UTSW 19 12108625 missense probably benign 0.09
R3835:Olfr1428 UTSW 19 12109400 missense possibly damaging 0.92
R4470:Olfr1428 UTSW 19 12109183 intron probably null
R4682:Olfr1428 UTSW 19 12108685 missense probably damaging 1.00
R4751:Olfr1428 UTSW 19 12109177 missense probably damaging 1.00
R5467:Olfr1428 UTSW 19 12108659 missense probably benign 0.20
R5513:Olfr1428 UTSW 19 12109381 missense probably damaging 1.00
R6915:Olfr1428 UTSW 19 12109126 missense probably benign 0.25
R7385:Olfr1428 UTSW 19 12108697 missense probably damaging 1.00
R7569:Olfr1428 UTSW 19 12109021 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACATGGGCGTGATGACAGTG -3'
(R):5'- TGCTAAACCCCTGCACTATG -3'

Sequencing Primer
(F):5'- GACAGTGTTATTGATAGATATGGCTG -3'
(R):5'- CCCTGCACTATGTAACCATTATGAGG -3'
Posted On2016-06-08