Incidental Mutation 'R0442:Iqgap3'
ID39206
Institutional Source Beutler Lab
Gene Symbol Iqgap3
Ensembl Gene ENSMUSG00000028068
Gene NameIQ motif containing GTPase activating protein 3
Synonyms
MMRRC Submission 038643-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R0442 (G1)
Quality Score151
Status Validated
Chromosome3
Chromosomal Location88081971-88121048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88115959 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 519 (P519L)
Ref Sequence ENSEMBL: ENSMUSP00000142035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071812] [ENSMUST00000194440]
Predicted Effect probably damaging
Transcript: ENSMUST00000071812
AA Change: P1417L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071715
Gene: ENSMUSG00000028068
AA Change: P1417L

DomainStartEndE-ValueType
CH 36 145 1.72e-14 SMART
internal_repeat_2 197 249 1.75e-5 PROSPERO
internal_repeat_1 209 418 1.31e-14 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 651 1.31e-14 PROSPERO
internal_repeat_2 600 652 1.75e-5 PROSPERO
IQ 730 752 1.18e1 SMART
IQ 760 782 3.76e-6 SMART
IQ 790 812 3.08e-2 SMART
IQ 820 842 1.72e0 SMART
RasGAP 977 1330 1.74e-57 SMART
Blast:RasGAP 1338 1422 1e-9 BLAST
Pfam:RasGAP_C 1434 1555 2e-36 PFAM
low complexity region 1591 1602 N/A INTRINSIC
low complexity region 1615 1630 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194440
AA Change: P519L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142035
Gene: ENSMUSG00000028068
AA Change: P519L

DomainStartEndE-ValueType
Blast:RasGAP 1 67 3e-30 BLAST
RasGAP 79 432 1e-59 SMART
Blast:RasGAP 440 524 5e-10 BLAST
Pfam:RasGAP_C 535 660 5.7e-30 PFAM
low complexity region 693 704 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194772
Meta Mutation Damage Score 0.402 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.5%
  • 10x: 93.4%
  • 20x: 81.2%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,396,470 N816Y probably damaging Het
Arfgef3 T C 10: 18,677,815 probably benign Het
Cd200 T A 16: 45,397,155 S58C probably damaging Het
Cep128 C T 12: 91,266,771 E508K probably damaging Het
Dnah2 C A 11: 69,448,542 L3046F probably damaging Het
Duox2 T C 2: 122,289,332 N872D probably benign Het
Fam90a1a C T 8: 21,963,058 T143I probably benign Het
Fdft1 T C 14: 63,163,349 T112A probably benign Het
Gimap9 G T 6: 48,678,066 G196* probably null Het
Grhl1 G A 12: 24,612,170 R536Q probably damaging Het
Gtpbp3 T A 8: 71,491,491 V293E probably damaging Het
Hcn3 A T 3: 89,151,540 F251Y probably damaging Het
Hectd4 T A 5: 121,323,982 C971S possibly damaging Het
Helz2 T A 2: 181,232,209 D2164V probably damaging Het
Hif1an T G 19: 44,566,012 L188R probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Jakmip1 T G 5: 37,135,553 probably null Het
Klra1 T C 6: 130,372,872 Y201C probably damaging Het
Minpp1 T C 19: 32,493,948 F299L possibly damaging Het
Myb A G 10: 21,126,196 S749P probably benign Het
Myo3b T C 2: 70,238,961 probably null Het
Naip1 T A 13: 100,444,516 R74S probably benign Het
Nt5m A G 11: 59,874,619 T158A possibly damaging Het
Obscn A T 11: 59,002,174 probably benign Het
Olfr1475 T G 19: 13,480,048 D50A probably damaging Het
Olfr312 T A 11: 58,831,431 Y92* probably null Het
Olfr800 T C 10: 129,659,824 I6T probably benign Het
Otogl T A 10: 107,876,855 T543S probably damaging Het
Pds5b T C 5: 150,716,544 probably benign Het
Plekhm1 A G 11: 103,397,174 M49T possibly damaging Het
Rabl6 A T 2: 25,587,522 S305R probably damaging Het
Rad54b G A 4: 11,609,480 probably benign Het
Rad54b C A 4: 11,610,362 R660S probably benign Het
Rexo5 T C 7: 119,843,285 L542P probably damaging Het
Rp1 C T 1: 4,346,747 D1381N probably benign Het
Scnn1a T G 6: 125,339,137 M346R probably damaging Het
Sirpb1c A G 3: 15,802,546 I380T probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sstr3 A T 15: 78,540,397 L50Q probably damaging Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Sun5 T C 2: 153,870,952 D16G possibly damaging Het
Svil A T 18: 5,046,870 T39S probably damaging Het
Taar1 A G 10: 23,920,482 Y26C possibly damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Use1 T C 8: 71,367,058 probably benign Het
Usp54 T C 14: 20,607,209 Y7C probably damaging Het
Zbtb37 A G 1: 161,032,348 F129S possibly damaging Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp28 T C 7: 6,394,999 L811P probably damaging Het
Zfp616 T C 11: 74,084,495 I530T possibly damaging Het
Other mutations in Iqgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Iqgap3 APN 3 88107560 missense probably damaging 1.00
IGL01062:Iqgap3 APN 3 88110122 missense probably benign 0.00
IGL01517:Iqgap3 APN 3 88109396 missense probably benign 0.09
IGL01530:Iqgap3 APN 3 88112303 critical splice acceptor site probably null
IGL01658:Iqgap3 APN 3 88115971 missense possibly damaging 0.89
IGL02027:Iqgap3 APN 3 88087342 missense possibly damaging 0.67
IGL02352:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02359:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02522:Iqgap3 APN 3 88108398 missense possibly damaging 0.94
IGL02717:Iqgap3 APN 3 88098359 missense probably benign 0.01
IGL02971:Iqgap3 APN 3 88090304 missense probably benign 0.30
IGL03079:Iqgap3 APN 3 88113170 missense probably benign
IGL03240:Iqgap3 APN 3 88114974 missense probably benign 0.00
adjutant UTSW 3 88101527 missense possibly damaging 0.51
booster UTSW 3 88113128 missense probably damaging 0.99
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0285:Iqgap3 UTSW 3 88096990 missense probably benign 0.11
R0490:Iqgap3 UTSW 3 88114056 splice site probably benign
R0569:Iqgap3 UTSW 3 88090725 splice site probably benign
R0747:Iqgap3 UTSW 3 88107503 splice site probably benign
R0843:Iqgap3 UTSW 3 88108431 missense possibly damaging 0.94
R1260:Iqgap3 UTSW 3 88114023 missense probably benign
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1544:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R1662:Iqgap3 UTSW 3 88098401 missense probably benign 0.33
R1686:Iqgap3 UTSW 3 88108356 splice site probably benign
R1748:Iqgap3 UTSW 3 88113980 missense possibly damaging 0.92
R1836:Iqgap3 UTSW 3 88108368 missense probably damaging 1.00
R1972:Iqgap3 UTSW 3 88083928 splice site probably null
R1973:Iqgap3 UTSW 3 88083928 splice site probably null
R2051:Iqgap3 UTSW 3 88120167 missense probably damaging 1.00
R2314:Iqgap3 UTSW 3 88116031 missense probably benign 0.01
R2352:Iqgap3 UTSW 3 88104508 missense possibly damaging 0.94
R2857:Iqgap3 UTSW 3 88107596 nonsense probably null
R2859:Iqgap3 UTSW 3 88107596 nonsense probably null
R3435:Iqgap3 UTSW 3 88094604 missense probably benign 0.00
R3522:Iqgap3 UTSW 3 88090782 missense probably null 0.90
R4281:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4283:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4397:Iqgap3 UTSW 3 88104358 missense probably damaging 1.00
R4414:Iqgap3 UTSW 3 88096986 missense probably benign
R4660:Iqgap3 UTSW 3 88120176 missense probably damaging 1.00
R4872:Iqgap3 UTSW 3 88113128 missense probably damaging 0.99
R4883:Iqgap3 UTSW 3 88107535 missense probably benign
R4915:Iqgap3 UTSW 3 88101527 missense possibly damaging 0.51
R5050:Iqgap3 UTSW 3 88090186 missense probably damaging 1.00
R5130:Iqgap3 UTSW 3 88108854 missense probably damaging 0.97
R5151:Iqgap3 UTSW 3 88117760 missense possibly damaging 0.58
R5645:Iqgap3 UTSW 3 88117699 missense probably damaging 1.00
R5706:Iqgap3 UTSW 3 88115908 missense probably benign 0.03
R5748:Iqgap3 UTSW 3 88109370 missense probably damaging 1.00
R5880:Iqgap3 UTSW 3 88117202 missense possibly damaging 0.67
R5982:Iqgap3 UTSW 3 88091592 nonsense probably null
R6006:Iqgap3 UTSW 3 88091547 missense probably damaging 0.98
R6026:Iqgap3 UTSW 3 88090171 missense probably damaging 1.00
R6188:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R6211:Iqgap3 UTSW 3 88091515 missense probably benign
R6291:Iqgap3 UTSW 3 88089730 critical splice donor site probably null
R6344:Iqgap3 UTSW 3 88082094 critical splice donor site probably null
R6854:Iqgap3 UTSW 3 88096951 missense probably damaging 1.00
R6875:Iqgap3 UTSW 3 88112771 frame shift probably null
R6877:Iqgap3 UTSW 3 88112771 frame shift probably null
R6958:Iqgap3 UTSW 3 88113366 missense possibly damaging 0.89
R7008:Iqgap3 UTSW 3 88112771 frame shift probably null
R7050:Iqgap3 UTSW 3 88098913 missense probably damaging 1.00
R7144:Iqgap3 UTSW 3 88116910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTGGGCCACCATAGATGATCC -3'
(R):5'- ACTGCCTTTGGAATGCCAGCAC -3'

Sequencing Primer
(F):5'- tgtttgtttgtttgtttgtttgtttg -3'
(R):5'- GCACATGGCTTTACAGCAG -3'
Posted On2013-05-23