Incidental Mutation 'IGL03052:Vmn2r79'
ID392181
Institutional Source Beutler Lab
Gene Symbol Vmn2r79
Ensembl Gene ENSMUSG00000090362
Gene Namevomeronasal 2, receptor 79
SynonymsEG621430
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #IGL03052 (G1)
Quality Score66
Status Validated
Chromosome7
Chromosomal Location86996465-87037968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87003591 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 497 (E497V)
Ref Sequence ENSEMBL: ENSMUSP00000132478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164462]
Predicted Effect probably benign
Transcript: ENSMUST00000164462
AA Change: E497V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132478
Gene: ENSMUSG00000090362
AA Change: E497V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 75 464 1.9e-31 PFAM
Pfam:NCD3G 506 559 3.1e-21 PFAM
Pfam:7tm_3 592 827 2.8e-53 PFAM
Meta Mutation Damage Score 0.1236 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik A T 16: 4,977,494 noncoding transcript Het
5830411N06Rik G A 7: 140,248,914 C162Y probably damaging Het
Acap3 T C 4: 155,903,358 F517S probably damaging Het
Afap1l1 A G 18: 61,748,823 V267A probably benign Het
Asap1 A G 15: 64,153,834 probably benign Het
Bcl6 T C 16: 23,975,038 probably benign Het
Ccdc73 C A 2: 104,951,936 H212Q possibly damaging Het
Cct5 A T 15: 31,597,487 H85Q probably damaging Het
Cfap69 A C 5: 5,589,206 L238R probably damaging Het
Chl1 A T 6: 103,691,667 T470S probably benign Het
Cnga4 T C 7: 105,404,725 S12P probably benign Het
Cyp2c29 C T 19: 39,287,218 T34M possibly damaging Het
Cyp2c67 T C 19: 39,648,885 D49G possibly damaging Het
Dab2ip A G 2: 35,643,897 Q45R probably benign Het
Ddhd1 A G 14: 45,620,783 V164A probably damaging Het
Dnah7c A G 1: 46,632,149 Y1566C probably damaging Het
Dnase1l2 T C 17: 24,440,994 probably benign Het
Dock2 G T 11: 34,232,853 N1593K probably benign Het
Dpp6 G T 5: 27,709,508 M530I probably benign Het
Epm2a T C 10: 11,457,230 V269A possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fgf2 A G 3: 37,349,012 S55G probably benign Het
Frem3 C T 8: 80,614,530 P1151S probably damaging Het
Gm12666 A G 4: 92,191,050 L178P probably benign Het
Gm15737 T C 6: 92,869,500 probably benign Het
Gm1840 T A 8: 5,639,816 noncoding transcript Het
Gm4759 T C 7: 106,423,695 noncoding transcript Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Macf1 T C 4: 123,387,395 I3770V probably damaging Het
Mapk15 G T 15: 75,993,882 R8L probably benign Het
Mecom C T 3: 29,960,963 probably benign Het
Mknk2 C T 10: 80,669,662 R154H probably benign Het
Mrgprb3 A T 7: 48,643,593 V70E possibly damaging Het
Mtdh A G 15: 34,140,730 K570E possibly damaging Het
Myo5c G T 9: 75,252,516 probably benign Het
Myom2 T C 8: 15,123,442 probably benign Het
Olfr1489 T C 19: 13,633,726 I205T probably benign Het
Olfr553 C T 7: 102,614,449 R180Q probably benign Het
Olfr843 A T 9: 19,248,642 Y252* probably null Het
Pcca A T 14: 122,887,101 M695L probably benign Het
Pcdha2 A T 18: 36,941,617 D767V probably damaging Het
Plekhs1 G A 19: 56,470,757 D16N probably benign Het
Prr11 T C 11: 87,103,652 N56S possibly damaging Het
Rxfp2 A T 5: 150,043,180 probably benign Het
Sacs G T 14: 61,207,858 G2451V probably damaging Het
Scarb1 G A 5: 125,294,099 A4V probably damaging Het
Sik3 C A 9: 46,198,149 T475K probably damaging Het
Slco1b2 A T 6: 141,648,585 I59L probably benign Het
Sspo G A 6: 48,460,453 G1382R probably damaging Het
Stx16 C A 2: 174,092,438 P145T probably benign Het
Tnrc18 G A 5: 142,775,219 A674V unknown Het
Uqcrq A G 11: 53,430,649 V14A possibly damaging Het
Vps8 T A 16: 21,448,365 I166K probably damaging Het
Vwa8 A G 14: 79,064,921 D1010G probably benign Het
Wnk1 T A 6: 119,944,799 probably benign Het
Zfand3 T A 17: 30,060,824 M29K probably benign Het
Other mutations in Vmn2r79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Vmn2r79 APN 7 87037273 missense probably benign 0.01
IGL01675:Vmn2r79 APN 7 86996648 missense probably benign 0.01
IGL01760:Vmn2r79 APN 7 87002158 missense probably benign
IGL01834:Vmn2r79 APN 7 87037146 missense probably benign 0.01
IGL01843:Vmn2r79 APN 7 87037277 missense probably damaging 1.00
IGL01914:Vmn2r79 APN 7 87037363 missense probably benign 0.14
IGL01980:Vmn2r79 APN 7 87037082 missense possibly damaging 0.49
IGL02438:Vmn2r79 APN 7 87002536 missense probably damaging 0.98
IGL02740:Vmn2r79 APN 7 87004158 missense probably benign 0.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0270:Vmn2r79 UTSW 7 87003386 missense probably benign 0.00
R0336:Vmn2r79 UTSW 7 87002079 missense probably benign 0.15
R0418:Vmn2r79 UTSW 7 87002403 missense probably benign 0.18
R1070:Vmn2r79 UTSW 7 87003473 missense probably damaging 1.00
R1234:Vmn2r79 UTSW 7 87004099 missense possibly damaging 0.71
R1459:Vmn2r79 UTSW 7 87037794 missense probably benign 0.01
R1513:Vmn2r79 UTSW 7 87037444 missense probably benign 0.01
R1624:Vmn2r79 UTSW 7 87004039 critical splice acceptor site probably null
R1633:Vmn2r79 UTSW 7 87037834 missense possibly damaging 0.52
R1676:Vmn2r79 UTSW 7 87002631 missense probably benign
R1781:Vmn2r79 UTSW 7 87002347 missense probably benign 0.00
R1794:Vmn2r79 UTSW 7 87001413 missense probably benign 0.37
R1823:Vmn2r79 UTSW 7 87037872 missense probably damaging 1.00
R2013:Vmn2r79 UTSW 7 87004081 missense possibly damaging 0.50
R2018:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2019:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2177:Vmn2r79 UTSW 7 86996631 missense possibly damaging 0.94
R2984:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R3719:Vmn2r79 UTSW 7 87002037 missense probably benign 0.05
R3798:Vmn2r79 UTSW 7 87002194 missense possibly damaging 0.88
R3969:Vmn2r79 UTSW 7 87003593 missense probably damaging 1.00
R4182:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4183:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4245:Vmn2r79 UTSW 7 87002416 missense possibly damaging 0.73
R4301:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4391:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4393:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4394:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4396:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4397:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4592:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R4697:Vmn2r79 UTSW 7 87037960 missense probably damaging 0.98
R4897:Vmn2r79 UTSW 7 87001467 missense probably benign
R5016:Vmn2r79 UTSW 7 87037340 missense probably benign 0.00
R5058:Vmn2r79 UTSW 7 87002215 missense probably damaging 0.98
R5177:Vmn2r79 UTSW 7 87001969 missense probably damaging 0.97
R6078:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6079:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6138:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6257:Vmn2r79 UTSW 7 87002570 missense probably benign 0.27
R6260:Vmn2r79 UTSW 7 87037157 missense probably benign 0.00
R6307:Vmn2r79 UTSW 7 87037768 missense probably damaging 1.00
R6323:Vmn2r79 UTSW 7 87001314 missense probably benign 0.05
R6374:Vmn2r79 UTSW 7 87002290 missense probably benign 0.02
R6530:Vmn2r79 UTSW 7 87002044 missense possibly damaging 0.91
R6546:Vmn2r79 UTSW 7 87003533 missense probably benign 0.01
R6682:Vmn2r79 UTSW 7 87004162 missense possibly damaging 0.69
R6858:Vmn2r79 UTSW 7 87037372 missense probably benign
R6965:Vmn2r79 UTSW 7 87001892 missense probably benign 0.10
R7130:Vmn2r79 UTSW 7 87002266 missense not run
U15987:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
X0054:Vmn2r79 UTSW 7 87004062 missense probably benign 0.01
Z1088:Vmn2r79 UTSW 7 87002341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTGTTGGAGACCTAATAAAC -3'
(R):5'- TGATTCACAAGAGAAAGCCATCG -3'

Sequencing Primer
(F):5'- GTTGGAGACCTAATAAACATGAACC -3'
(R):5'- TCAAATAGCTGGAGAGATACAGAG -3'
Posted On2016-06-09