Incidental Mutation 'IGL03052:Ddhd1'
ID392194
Institutional Source Beutler Lab
Gene Symbol Ddhd1
Ensembl Gene ENSMUSG00000037697
Gene NameDDHD domain containing 1
Synonyms9630061G18Rik, 4921528E07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #IGL03052 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location45588467-45658143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45620783 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000154065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051310] [ENSMUST00000087320] [ENSMUST00000111828] [ENSMUST00000149286] [ENSMUST00000226301]
Predicted Effect probably damaging
Transcript: ENSMUST00000051310
AA Change: V341A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050088
Gene: ENSMUSG00000037697
AA Change: V341A

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 6e-67 BLAST
DDHD 595 842 1.49e-100 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087320
AA Change: V375A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084577
Gene: ENSMUSG00000037697
AA Change: V375A

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 484 607 1e-66 BLAST
DDHD 629 904 3.75e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111828
AA Change: V341A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107459
Gene: ENSMUSG00000037697
AA Change: V341A

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 8e-67 BLAST
DDHD 595 870 3.75e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129599
Predicted Effect unknown
Transcript: ENSMUST00000141487
AA Change: V1A
SMART Domains Protein: ENSMUSP00000133358
Gene: ENSMUSG00000037697
AA Change: V1A

DomainStartEndE-ValueType
Blast:DDHD 111 149 1e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147551
Predicted Effect probably benign
Transcript: ENSMUST00000149286
SMART Domains Protein: ENSMUSP00000118848
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152110
Predicted Effect probably damaging
Transcript: ENSMUST00000226301
AA Change: V164A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the intracellular phospholipase A1 gene family. The protein encoded by this gene preferentially hydrolyzes phosphatidic acid. It is a cytosolic protein with some mitochondrial localization, and is thought to be involved in the regulation of mitochondrial dynamics. Overexpression of this gene causes fragmentation of the tubular structures in mitochondria, while depletion of the gene results in mitochondrial tubule elongation. Deletion of this gene in male mice caused fertility defects, resulting from disruption in the organization of the mitochondria during spermiogenesis. In humans, mutations in this gene have been associated with hereditary spastic paraplegia (HSP), also known as Strumpell-Lorrain disease, or, familial spastic paraparesis (FSP). This inherited disorder is characterized by progressive weakness and spasticity of the legs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele show reduced testis weight, oligozoospermia, teratozoospermia, and male subfertility. Sperm defects include a disorganized mitochondrial structure, an abnormal gap between the middle and principal pieces, and hairpin flagellum leading to impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik A T 16: 4,977,494 noncoding transcript Het
5830411N06Rik G A 7: 140,248,914 C162Y probably damaging Het
Acap3 T C 4: 155,903,358 F517S probably damaging Het
Afap1l1 A G 18: 61,748,823 V267A probably benign Het
Asap1 A G 15: 64,153,834 probably benign Het
Bcl6 T C 16: 23,975,038 probably benign Het
Ccdc73 C A 2: 104,951,936 H212Q possibly damaging Het
Cct5 A T 15: 31,597,487 H85Q probably damaging Het
Cfap69 A C 5: 5,589,206 L238R probably damaging Het
Chl1 A T 6: 103,691,667 T470S probably benign Het
Cnga4 T C 7: 105,404,725 S12P probably benign Het
Cyp2c29 C T 19: 39,287,218 T34M possibly damaging Het
Cyp2c67 T C 19: 39,648,885 D49G possibly damaging Het
Dab2ip A G 2: 35,643,897 Q45R probably benign Het
Dnah7c A G 1: 46,632,149 Y1566C probably damaging Het
Dnase1l2 T C 17: 24,440,994 probably benign Het
Dock2 G T 11: 34,232,853 N1593K probably benign Het
Dpp6 G T 5: 27,709,508 M530I probably benign Het
Epm2a T C 10: 11,457,230 V269A possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fgf2 A G 3: 37,349,012 S55G probably benign Het
Frem3 C T 8: 80,614,530 P1151S probably damaging Het
Gm12666 A G 4: 92,191,050 L178P probably benign Het
Gm15737 T C 6: 92,869,500 probably benign Het
Gm1840 T A 8: 5,639,816 noncoding transcript Het
Gm4759 T C 7: 106,423,695 noncoding transcript Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Macf1 T C 4: 123,387,395 I3770V probably damaging Het
Mapk15 G T 15: 75,993,882 R8L probably benign Het
Mecom C T 3: 29,960,963 probably benign Het
Mknk2 C T 10: 80,669,662 R154H probably benign Het
Mrgprb3 A T 7: 48,643,593 V70E possibly damaging Het
Mtdh A G 15: 34,140,730 K570E possibly damaging Het
Myo5c G T 9: 75,252,516 probably benign Het
Myom2 T C 8: 15,123,442 probably benign Het
Olfr1489 T C 19: 13,633,726 I205T probably benign Het
Olfr553 C T 7: 102,614,449 R180Q probably benign Het
Olfr843 A T 9: 19,248,642 Y252* probably null Het
Pcca A T 14: 122,887,101 M695L probably benign Het
Pcdha2 A T 18: 36,941,617 D767V probably damaging Het
Plekhs1 G A 19: 56,470,757 D16N probably benign Het
Prr11 T C 11: 87,103,652 N56S possibly damaging Het
Rxfp2 A T 5: 150,043,180 probably benign Het
Sacs G T 14: 61,207,858 G2451V probably damaging Het
Scarb1 G A 5: 125,294,099 A4V probably damaging Het
Sik3 C A 9: 46,198,149 T475K probably damaging Het
Slco1b2 A T 6: 141,648,585 I59L probably benign Het
Sspo G A 6: 48,460,453 G1382R probably damaging Het
Stx16 C A 2: 174,092,438 P145T probably benign Het
Tnrc18 G A 5: 142,775,219 A674V unknown Het
Uqcrq A G 11: 53,430,649 V14A possibly damaging Het
Vmn2r79 A T 7: 87,003,591 E497V probably benign Het
Vps8 T A 16: 21,448,365 I166K probably damaging Het
Vwa8 A G 14: 79,064,921 D1010G probably benign Het
Wnk1 T A 6: 119,944,799 probably benign Het
Zfand3 T A 17: 30,060,824 M29K probably benign Het
Other mutations in Ddhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Ddhd1 APN 14 45616551 missense probably damaging 1.00
IGL01635:Ddhd1 APN 14 45629580 missense probably null 0.98
IGL02176:Ddhd1 APN 14 45616600 missense probably damaging 1.00
IGL02698:Ddhd1 APN 14 45605206 unclassified probably benign
PIT4434001:Ddhd1 UTSW 14 45610605 missense possibly damaging 0.62
R0037:Ddhd1 UTSW 14 45610510 missense probably damaging 1.00
R0105:Ddhd1 UTSW 14 45610690 missense probably benign 0.37
R0165:Ddhd1 UTSW 14 45595592 missense probably damaging 1.00
R1237:Ddhd1 UTSW 14 45601650 missense probably benign 0.01
R1401:Ddhd1 UTSW 14 45605051 critical splice donor site probably null
R1574:Ddhd1 UTSW 14 45595547 missense probably damaging 1.00
R1574:Ddhd1 UTSW 14 45595547 missense probably damaging 1.00
R1582:Ddhd1 UTSW 14 45605109 missense probably damaging 0.98
R2070:Ddhd1 UTSW 14 45610624 missense probably damaging 1.00
R2307:Ddhd1 UTSW 14 45608990 missense probably damaging 1.00
R2417:Ddhd1 UTSW 14 45657272 missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45610573 missense probably benign 0.00
R3756:Ddhd1 UTSW 14 45657263 missense probably damaging 1.00
R4541:Ddhd1 UTSW 14 45622856 nonsense probably null
R4737:Ddhd1 UTSW 14 45628821 intron probably benign
R5105:Ddhd1 UTSW 14 45657407 missense probably benign 0.00
R5810:Ddhd1 UTSW 14 45602707 missense probably damaging 1.00
R5898:Ddhd1 UTSW 14 45602668 missense probably damaging 1.00
R6217:Ddhd1 UTSW 14 45619514 intron probably null
R6218:Ddhd1 UTSW 14 45614176 missense probably damaging 1.00
R6671:Ddhd1 UTSW 14 45657232 frame shift probably null
R6787:Ddhd1 UTSW 14 45657519 missense probably benign 0.01
R7049:Ddhd1 UTSW 14 45602681 missense probably damaging 1.00
R7150:Ddhd1 UTSW 14 45657806 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATTCCTGTCCTTGTCAGAG -3'
(R):5'- CCTGAAGTCCATGGTGTCTGAG -3'

Sequencing Primer
(F):5'- CCTAATTCTGAGCTGATGAGTGAC -3'
(R):5'- CCATGGTGTCTGAGTTAGAGAATAC -3'
Posted On2016-06-09