Incidental Mutation 'IGL03047:Tm9sf4'
ID392214
Institutional Source Beutler Lab
Gene Symbol Tm9sf4
Ensembl Gene ENSMUSG00000068040
Gene Nametransmembrane 9 superfamily protein member 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL03047 (G1)
Quality Score111
Status Validated
Chromosome2
Chromosomal Location153161303-153210466 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 153161406 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000086422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089027]
Predicted Effect probably benign
Transcript: ENSMUST00000089027
SMART Domains Protein: ENSMUSP00000086422
Gene: ENSMUSG00000068040

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMP70 55 600 5.3e-203 PFAM
transmembrane domain 605 627 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147978
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Homozygous mutants exhibit abnormal hair follicles and sebaceous glands, vertebrae and rib abnormalities, and increased circulating cholesterol, calcium, albumin, and total protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,512,641 H21Q possibly damaging Het
4933427D14Rik A G 11: 72,166,726 I749T possibly damaging Het
Adam22 A G 5: 8,082,220 S869P probably damaging Het
Add3 A G 19: 53,242,591 T566A probably benign Het
Asic3 A C 5: 24,413,790 M27L probably benign Het
Atp2c1 T A 9: 105,521,007 probably benign Het
Cabin1 A T 10: 75,700,100 probably benign Het
Ccr7 C T 11: 99,145,334 R254H probably benign Het
Cdk2ap1 G T 5: 124,348,690 A63E possibly damaging Het
Cfap70 T C 14: 20,448,578 T14A possibly damaging Het
Cldn11 T A 3: 31,163,107 F141L probably damaging Het
Comp G T 8: 70,374,909 A107S possibly damaging Het
Cyp2b23 A T 7: 26,681,467 probably benign Het
Cyp2c68 T G 19: 39,734,460 I215L probably benign Het
Cyp4f17 T A 17: 32,524,049 I232K possibly damaging Het
Dram2 T G 3: 106,573,029 F219L probably damaging Het
Fam186a G A 15: 99,945,708 A885V unknown Het
Fbxo42 A G 4: 141,199,542 T378A possibly damaging Het
Frmpd1 T A 4: 45,283,993 V938E probably damaging Het
Gramd1c C A 16: 43,988,247 L489F probably damaging Het
Il17ra T C 6: 120,481,226 I446T probably damaging Het
Il1f9 G A 2: 24,192,707 A165T probably damaging Het
Kcne4 G T 1: 78,817,778 V48F possibly damaging Het
Ly6g6c T A 17: 35,069,349 probably null Het
Mars2 A G 1: 55,238,873 Y545C probably benign Het
Mmp12 T G 9: 7,357,797 probably benign Het
Mthfd1l T A 10: 3,980,409 probably benign Het
Nop14 C T 5: 34,660,014 R11K possibly damaging Het
Npas3 T A 12: 53,831,687 probably benign Het
Odf2 A T 2: 29,920,895 probably benign Het
Olfr1140 A G 2: 87,746,994 Y266C possibly damaging Het
Olfr1389 A G 11: 49,430,967 M164V probably benign Het
Olfr498 T C 7: 108,465,776 S151P probably damaging Het
Olfr750 A G 14: 51,071,156 I79T possibly damaging Het
Otud7b T C 3: 96,150,984 probably benign Het
Papd7 C A 13: 69,502,911 D369Y probably damaging Het
Plcg1 T C 2: 160,754,879 Y747H probably damaging Het
Runx1t1 G A 4: 13,865,882 V357I probably damaging Het
Seh1l C G 18: 67,789,450 T291R probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Sulf2 G T 2: 166,080,894 probably null Het
Tex14 C T 11: 87,536,704 S1174F probably damaging Het
Vmn2r7 G A 3: 64,707,218 H392Y possibly damaging Het
Zfhx4 T A 3: 5,243,733 V673D probably damaging Het
Other mutations in Tm9sf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Tm9sf4 APN 2 153202355 missense probably damaging 1.00
IGL02218:Tm9sf4 APN 2 153204616 missense probably benign 0.00
IGL02354:Tm9sf4 APN 2 153187650 missense probably benign
IGL02361:Tm9sf4 APN 2 153187650 missense probably benign
R0079:Tm9sf4 UTSW 2 153191145 missense probably damaging 1.00
R0147:Tm9sf4 UTSW 2 153195313 missense probably benign 0.01
R0650:Tm9sf4 UTSW 2 153187365 missense probably benign 0.00
R0729:Tm9sf4 UTSW 2 153191145 missense probably damaging 1.00
R0739:Tm9sf4 UTSW 2 153203814 missense probably damaging 1.00
R1695:Tm9sf4 UTSW 2 153190912 missense probably benign 0.00
R2321:Tm9sf4 UTSW 2 153204586 missense probably damaging 1.00
R3608:Tm9sf4 UTSW 2 153178977 missense probably benign
R4031:Tm9sf4 UTSW 2 153198344 splice site probably benign
R4668:Tm9sf4 UTSW 2 153187308 missense probably damaging 1.00
R4669:Tm9sf4 UTSW 2 153187308 missense probably damaging 1.00
R5318:Tm9sf4 UTSW 2 153187656 missense probably benign
R5580:Tm9sf4 UTSW 2 153182430 missense probably damaging 1.00
R5705:Tm9sf4 UTSW 2 153182458 missense probably benign 0.00
R5870:Tm9sf4 UTSW 2 153194281 missense probably damaging 1.00
R5996:Tm9sf4 UTSW 2 153195571 splice site probably null
R6115:Tm9sf4 UTSW 2 153182489 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAACGACTCTTTCTGCCAATAC -3'
(R):5'- ATGCCATGCCAAGGCTAGAG -3'

Sequencing Primer
(F):5'- CGACTCTTTCTGCCAATACTAAAG -3'
(R):5'- TTTGTAGAGGCCGACCCAGTC -3'
Posted On2016-06-09