Incidental Mutation 'IGL03047:Cldn11'
ID 392217
Institutional Source Beutler Lab
Gene Symbol Cldn11
Ensembl Gene ENSMUSG00000037625
Gene Name claudin 11
Synonyms Otm, Osp, oligodendrocyte-specific protein
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # IGL03047 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 31204069-31218473 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31217256 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 141 (F141L)
Ref Sequence ENSEMBL: ENSMUSP00000042181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046174]
AlphaFold Q60771
Predicted Effect probably damaging
Transcript: ENSMUST00000046174
AA Change: F141L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042181
Gene: ENSMUSG00000037625
AA Change: F141L

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 175 2.6e-22 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a major component of CNS (central nervous system) myelin and plays an important role in regulating proliferation and migration of oligodendrocytes. The basal cell tight junctions in stria vascularis are primarily composed of this protein, and the gene-null mice suffer severe deafness. This protein is also an obligatory protein for tight junction formation and barrier integrity in the testis and the gene deficiency results in loss of the Sertoli cell epithelial phenotype in the testis. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygous null mice exhibit tremors, impaired coordination, hindlimb weakness, abnormal myelination of the cranial nerves, increased auditory thresholds, and abnormal stria vascularis. Mutant males have small testes, abnormal seminiferous tubules, and sperm abnormalities resulting in infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,246,568 (GRCm39) H21Q possibly damaging Het
4933427D14Rik A G 11: 72,057,552 (GRCm39) I749T possibly damaging Het
Adam22 A G 5: 8,132,220 (GRCm39) S869P probably damaging Het
Add3 A G 19: 53,231,022 (GRCm39) T566A probably benign Het
Asic3 A C 5: 24,618,788 (GRCm39) M27L probably benign Het
Atp2c1 T A 9: 105,398,206 (GRCm39) probably benign Het
Cabin1 A T 10: 75,535,934 (GRCm39) probably benign Het
Ccr7 C T 11: 99,036,160 (GRCm39) R254H probably benign Het
Cdk2ap1 G T 5: 124,486,753 (GRCm39) A63E possibly damaging Het
Cfap70 T C 14: 20,498,646 (GRCm39) T14A possibly damaging Het
Comp G T 8: 70,827,559 (GRCm39) A107S possibly damaging Het
Cyp2b23 A T 7: 26,380,892 (GRCm39) probably benign Het
Cyp2c68 T G 19: 39,722,904 (GRCm39) I215L probably benign Het
Cyp4f17 T A 17: 32,743,023 (GRCm39) I232K possibly damaging Het
Dram2 T G 3: 106,480,345 (GRCm39) F219L probably damaging Het
Fam186a G A 15: 99,843,589 (GRCm39) A885V unknown Het
Fbxo42 A G 4: 140,926,853 (GRCm39) T378A possibly damaging Het
Frmpd1 T A 4: 45,283,993 (GRCm39) V938E probably damaging Het
Gramd1c C A 16: 43,808,610 (GRCm39) L489F probably damaging Het
Il17ra T C 6: 120,458,187 (GRCm39) I446T probably damaging Het
Il36g G A 2: 24,082,719 (GRCm39) A165T probably damaging Het
Kcne4 G T 1: 78,795,495 (GRCm39) V48F possibly damaging Het
Ly6g6c T A 17: 35,288,325 (GRCm39) probably null Het
Mars2 A G 1: 55,278,032 (GRCm39) Y545C probably benign Het
Mmp12 T G 9: 7,357,797 (GRCm39) probably benign Het
Mthfd1l T A 10: 3,930,409 (GRCm39) probably benign Het
Nop14 C T 5: 34,817,358 (GRCm39) R11K possibly damaging Het
Npas3 T A 12: 53,878,470 (GRCm39) probably benign Het
Odf2 A T 2: 29,810,907 (GRCm39) probably benign Het
Or2y1d A G 11: 49,321,794 (GRCm39) M164V probably benign Het
Or5p73 T C 7: 108,064,983 (GRCm39) S151P probably damaging Het
Or5w16 A G 2: 87,577,338 (GRCm39) Y266C possibly damaging Het
Or6s1 A G 14: 51,308,613 (GRCm39) I79T possibly damaging Het
Otud7b T C 3: 96,058,301 (GRCm39) probably benign Het
Plcg1 T C 2: 160,596,799 (GRCm39) Y747H probably damaging Het
Runx1t1 G A 4: 13,865,882 (GRCm39) V357I probably damaging Het
Seh1l C G 18: 67,922,520 (GRCm39) T291R probably damaging Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Sulf2 G T 2: 165,922,814 (GRCm39) probably null Het
Tent4a C A 13: 69,651,030 (GRCm39) D369Y probably damaging Het
Tex14 C T 11: 87,427,530 (GRCm39) S1174F probably damaging Het
Tm9sf4 A G 2: 153,003,326 (GRCm39) probably benign Het
Vmn2r7 G A 3: 64,614,639 (GRCm39) H392Y possibly damaging Het
Zfhx4 T A 3: 5,308,793 (GRCm39) V673D probably damaging Het
Other mutations in Cldn11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02123:Cldn11 APN 3 31,204,336 (GRCm39) missense probably benign 0.01
IGL02403:Cldn11 APN 3 31,204,345 (GRCm39) missense probably benign 0.00
R2122:Cldn11 UTSW 3 31,217,300 (GRCm39) missense probably damaging 1.00
R4082:Cldn11 UTSW 3 31,217,278 (GRCm39) missense probably benign 0.00
R5589:Cldn11 UTSW 3 31,204,395 (GRCm39) missense probably damaging 0.96
R7591:Cldn11 UTSW 3 31,204,436 (GRCm39) missense probably benign 0.24
R8174:Cldn11 UTSW 3 31,208,210 (GRCm39) missense probably benign 0.12
R8357:Cldn11 UTSW 3 31,217,342 (GRCm39) missense probably benign 0.10
R8457:Cldn11 UTSW 3 31,217,342 (GRCm39) missense probably benign 0.10
R8694:Cldn11 UTSW 3 31,217,239 (GRCm39) missense probably damaging 1.00
R9098:Cldn11 UTSW 3 31,217,276 (GRCm39) missense probably damaging 1.00
R9376:Cldn11 UTSW 3 31,217,410 (GRCm39) missense possibly damaging 0.69
Z1176:Cldn11 UTSW 3 31,204,455 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTGTCAGTGCATTCTTAGAG -3'
(R):5'- AGCAGCCCTCTTAGACATGG -3'

Sequencing Primer
(F):5'- TCAGTGCATTCTTAGAGCAGAG -3'
(R):5'- CTCTTAGACATGGGCACTCTTGG -3'
Posted On 2016-06-09