Incidental Mutation 'IGL03047:Frmpd1'
ID392221
Institutional Source Beutler Lab
Gene Symbol Frmpd1
Ensembl Gene ENSMUSG00000035615
Gene NameFERM and PDZ domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL03047 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45184875-45285936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45283993 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 938 (V938E)
Ref Sequence ENSEMBL: ENSMUSP00000103434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044773] [ENSMUST00000107804]
Predicted Effect probably damaging
Transcript: ENSMUST00000044773
AA Change: V938E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047232
Gene: ENSMUSG00000035615
AA Change: V938E

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107804
AA Change: V938E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103434
Gene: ENSMUSG00000035615
AA Change: V938E

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,512,641 H21Q possibly damaging Het
4933427D14Rik A G 11: 72,166,726 I749T possibly damaging Het
Adam22 A G 5: 8,082,220 S869P probably damaging Het
Add3 A G 19: 53,242,591 T566A probably benign Het
Asic3 A C 5: 24,413,790 M27L probably benign Het
Atp2c1 T A 9: 105,521,007 probably benign Het
Cabin1 A T 10: 75,700,100 probably benign Het
Ccr7 C T 11: 99,145,334 R254H probably benign Het
Cdk2ap1 G T 5: 124,348,690 A63E possibly damaging Het
Cfap70 T C 14: 20,448,578 T14A possibly damaging Het
Cldn11 T A 3: 31,163,107 F141L probably damaging Het
Comp G T 8: 70,374,909 A107S possibly damaging Het
Cyp2b23 A T 7: 26,681,467 probably benign Het
Cyp2c68 T G 19: 39,734,460 I215L probably benign Het
Cyp4f17 T A 17: 32,524,049 I232K possibly damaging Het
Dram2 T G 3: 106,573,029 F219L probably damaging Het
Fam186a G A 15: 99,945,708 A885V unknown Het
Fbxo42 A G 4: 141,199,542 T378A possibly damaging Het
Gramd1c C A 16: 43,988,247 L489F probably damaging Het
Il17ra T C 6: 120,481,226 I446T probably damaging Het
Il1f9 G A 2: 24,192,707 A165T probably damaging Het
Kcne4 G T 1: 78,817,778 V48F possibly damaging Het
Ly6g6c T A 17: 35,069,349 probably null Het
Mars2 A G 1: 55,238,873 Y545C probably benign Het
Mmp12 T G 9: 7,357,797 probably benign Het
Mthfd1l T A 10: 3,980,409 probably benign Het
Nop14 C T 5: 34,660,014 R11K possibly damaging Het
Npas3 T A 12: 53,831,687 probably benign Het
Odf2 A T 2: 29,920,895 probably benign Het
Olfr1140 A G 2: 87,746,994 Y266C possibly damaging Het
Olfr1389 A G 11: 49,430,967 M164V probably benign Het
Olfr498 T C 7: 108,465,776 S151P probably damaging Het
Olfr750 A G 14: 51,071,156 I79T possibly damaging Het
Otud7b T C 3: 96,150,984 probably benign Het
Papd7 C A 13: 69,502,911 D369Y probably damaging Het
Plcg1 T C 2: 160,754,879 Y747H probably damaging Het
Runx1t1 G A 4: 13,865,882 V357I probably damaging Het
Seh1l C G 18: 67,789,450 T291R probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Sulf2 G T 2: 166,080,894 probably null Het
Tex14 C T 11: 87,536,704 S1174F probably damaging Het
Tm9sf4 A G 2: 153,161,406 probably benign Het
Vmn2r7 G A 3: 64,707,218 H392Y possibly damaging Het
Zfhx4 T A 3: 5,243,733 V673D probably damaging Het
Other mutations in Frmpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Frmpd1 APN 4 45279456 missense possibly damaging 0.61
IGL01678:Frmpd1 APN 4 45243717 missense probably damaging 1.00
IGL01815:Frmpd1 APN 4 45284239 missense probably benign
IGL02305:Frmpd1 APN 4 45249209 missense probably damaging 1.00
IGL02347:Frmpd1 APN 4 45270023 splice site probably null
IGL02586:Frmpd1 APN 4 45285160 missense probably damaging 1.00
IGL02704:Frmpd1 APN 4 45285082 missense possibly damaging 0.83
IGL02942:Frmpd1 APN 4 45285493 missense probably damaging 0.99
IGL03353:Frmpd1 APN 4 45261926 missense probably damaging 1.00
IGL03355:Frmpd1 APN 4 45279140 missense probably damaging 1.00
IGL03401:Frmpd1 APN 4 45284383 missense probably benign 0.28
R0094:Frmpd1 UTSW 4 45284899 nonsense probably null
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0375:Frmpd1 UTSW 4 45284196 missense probably benign 0.00
R0508:Frmpd1 UTSW 4 45284938 missense unknown
R0524:Frmpd1 UTSW 4 45256902 missense probably damaging 1.00
R0524:Frmpd1 UTSW 4 45283774 missense probably benign 0.00
R0625:Frmpd1 UTSW 4 45284055 missense probably benign
R0825:Frmpd1 UTSW 4 45285394 missense possibly damaging 0.93
R0926:Frmpd1 UTSW 4 45268497 missense probably damaging 1.00
R0975:Frmpd1 UTSW 4 45279000 missense probably benign 0.01
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1573:Frmpd1 UTSW 4 45283932 missense probably benign 0.01
R1938:Frmpd1 UTSW 4 45283711 missense probably damaging 1.00
R2334:Frmpd1 UTSW 4 45285408 missense probably damaging 0.97
R2413:Frmpd1 UTSW 4 45278969 missense probably benign 0.02
R2760:Frmpd1 UTSW 4 45244667 missense possibly damaging 0.77
R3856:Frmpd1 UTSW 4 45283698 missense probably damaging 1.00
R3876:Frmpd1 UTSW 4 45284093 missense probably benign 0.01
R4080:Frmpd1 UTSW 4 45284382 missense probably benign
R4597:Frmpd1 UTSW 4 45274441 missense probably benign 0.12
R4714:Frmpd1 UTSW 4 45284785 missense probably benign 0.11
R4779:Frmpd1 UTSW 4 45229865 missense probably damaging 1.00
R4957:Frmpd1 UTSW 4 45273099 missense probably damaging 1.00
R5000:Frmpd1 UTSW 4 45261931 splice site probably null
R5041:Frmpd1 UTSW 4 45278878 missense probably damaging 1.00
R5228:Frmpd1 UTSW 4 45284322 missense probably damaging 0.98
R5413:Frmpd1 UTSW 4 45249196 missense probably benign 0.00
R5560:Frmpd1 UTSW 4 45243697 missense probably damaging 1.00
R6133:Frmpd1 UTSW 4 45284915 missense probably benign 0.01
R6158:Frmpd1 UTSW 4 45285401 missense probably damaging 1.00
R6329:Frmpd1 UTSW 4 45268551 missense possibly damaging 0.80
R6338:Frmpd1 UTSW 4 45274489 missense probably benign 0.00
R6544:Frmpd1 UTSW 4 45279024 missense probably damaging 1.00
R6728:Frmpd1 UTSW 4 45284664 missense probably benign
R6748:Frmpd1 UTSW 4 45274397 missense probably benign 0.08
R6798:Frmpd1 UTSW 4 45284850 missense probably benign 0.17
R6828:Frmpd1 UTSW 4 45275383 missense probably damaging 0.99
R7002:Frmpd1 UTSW 4 45284200 missense probably benign
R7258:Frmpd1 UTSW 4 45269974 missense possibly damaging 0.79
R7295:Frmpd1 UTSW 4 45285700 missense probably damaging 1.00
R7382:Frmpd1 UTSW 4 45278880 missense probably benign 0.00
R7423:Frmpd1 UTSW 4 45256948 missense probably damaging 1.00
R7451:Frmpd1 UTSW 4 45279558 missense probably benign 0.11
R7492:Frmpd1 UTSW 4 45285237 missense possibly damaging 0.71
R7524:Frmpd1 UTSW 4 45271181 missense probably benign 0.16
Z1088:Frmpd1 UTSW 4 45284080 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGATGTGTGCTACTATGACCGAG -3'
(R):5'- CCTGGGTCTTGATCTGGAGATAC -3'

Sequencing Primer
(F):5'- TATGACCGAGAGCCCTACCTG -3'
(R):5'- TACGATTGGAAAAGGCCTGACTTG -3'
Posted On2016-06-09