Incidental Mutation 'IGL02799:Celsr2'
ID392259
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Namecadherin, EGF LAG seven-pass G-type receptor 2
Synonymsmfmi1, EGFL2, flamingo
Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL02799 (G1)
Quality Score137
Status Validated
Chromosome3
Chromosomal Location108390851-108415552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108414062 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 478 (D478V)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
Predicted Effect probably damaging
Transcript: ENSMUST00000090558
AA Change: D478V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: D478V

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Meta Mutation Damage Score 0.46 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 A G 6: 86,106,252 N444S possibly damaging Het
Atp2b2 A T 6: 113,762,852 Y823* probably null Het
Atp2c1 A C 9: 105,413,043 probably benign Het
Capns1 A T 7: 30,192,219 D133E probably benign Het
Cast A G 13: 74,736,752 V361A probably damaging Het
Cd69 G A 6: 129,268,260 probably benign Het
Cenpf T C 1: 189,659,652 E661G probably damaging Het
Chrna1 A G 2: 73,574,641 probably benign Het
Clec5a C A 6: 40,578,049 V138F probably damaging Het
Ctsj T A 13: 61,003,820 I95F probably benign Het
Dcaf1 T A 9: 106,857,940 S696T probably benign Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnajc14 C T 10: 128,806,856 P216S possibly damaging Het
Dst T C 1: 34,179,849 I1790T possibly damaging Het
Ehmt1 A T 2: 24,815,806 H789Q probably damaging Het
Exoc7 A T 11: 116,301,181 L188Q probably damaging Het
Faap100 A G 11: 120,370,735 L823P probably damaging Het
Fdxacb1 T A 9: 50,772,596 S620T probably benign Het
Fhl2 C T 1: 43,128,402 R177Q probably benign Het
Gars C A 6: 55,063,099 T337K probably damaging Het
Ggta1 A T 2: 35,422,199 F56I probably damaging Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gpr108 T A 17: 57,237,482 I343F probably damaging Het
Gpr12 T A 5: 146,583,819 I98F possibly damaging Het
Hk2 A G 6: 82,760,238 L3P probably damaging Het
Imp4 C A 1: 34,440,177 probably benign Het
Insrr G A 3: 87,813,581 V1049M probably damaging Het
Klhl24 T C 16: 20,114,581 V314A probably damaging Het
Krt32 A T 11: 100,087,907 V107D possibly damaging Het
Krtap5-1 G A 7: 142,296,505 Q189* probably null Het
Lrrc9 A G 12: 72,506,404 E1360G probably damaging Het
Mdc1 G T 17: 35,846,191 L163F possibly damaging Het
Mroh1 T G 15: 76,392,461 probably null Het
Myh8 A G 11: 67,301,592 probably benign Het
Ndufab1 A T 7: 122,093,726 probably benign Het
Nek3 A G 8: 22,158,719 probably benign Het
Ngly1 A T 14: 16,260,636 I107L probably benign Het
Nkain4 A T 2: 180,935,935 probably null Het
Nsd2 T A 5: 33,864,788 probably benign Het
Olfr1094 A T 2: 86,828,956 H68L probably damaging Het
Olfr513 A T 7: 108,755,623 M256L probably benign Het
Olfr732 A G 14: 50,281,344 I303T probably benign Het
Olfr857 T A 9: 19,713,018 Y64N probably damaging Het
Olfr874 T A 9: 37,746,509 I125N probably damaging Het
Pcnt G A 10: 76,412,583 Q901* probably null Het
Pctp C A 11: 89,991,087 W81C probably damaging Het
Pik3r5 A T 11: 68,495,947 I801F probably damaging Het
Ptprj A T 2: 90,469,598 N193K probably benign Het
Rab11fip1 A T 8: 27,152,760 D670E probably benign Het
Racgap1 T C 15: 99,632,747 K201E probably benign Het
Ranbp2 T C 10: 58,480,264 F2269L probably damaging Het
Rint1 C A 5: 23,819,480 A760D possibly damaging Het
Ryr2 G A 13: 11,665,962 P3166S probably damaging Het
Snap29 A G 16: 17,422,503 N158D probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
St6galnac1 G T 11: 116,766,647 probably benign Het
Strc G A 2: 121,379,236 T202I probably damaging Het
Stxbp4 A G 11: 90,494,600 probably null Het
Syne1 A T 10: 5,359,059 M650K probably damaging Het
Tbc1d2b C T 9: 90,223,434 probably benign Het
Tcfl5 A T 2: 180,638,626 I328N possibly damaging Het
Tenm2 A G 11: 36,273,408 Y337H probably damaging Het
Tgfbr2 T C 9: 116,110,136 K233E possibly damaging Het
Tnk2 T C 16: 32,665,881 probably benign Het
Trbv13-2 A G 6: 41,121,537 probably benign Het
Usp6nl T A 2: 6,427,549 probably benign Het
Vmn2r62 A G 7: 42,787,972 S363P possibly damaging Het
Vnn3 T C 10: 23,851,971 I93T possibly damaging Het
Ylpm1 A G 12: 85,044,484 D1108G probably damaging Het
Zbtb17 G A 4: 141,463,380 G170S probably benign Het
Zcchc11 T C 4: 108,513,528 Y875H probably benign Het
Zfyve26 T C 12: 79,273,310 E1087G probably benign Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108413879 missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108403270 missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108393763 missense probably benign 0.13
IGL01448:Celsr2 APN 3 108393239 missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108406867 missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108414843 missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108394022 missense probably benign 0.00
IGL02309:Celsr2 APN 3 108396011 missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108412871 missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108413955 missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108397510 missense probably benign 0.01
IGL02812:Celsr2 APN 3 108414113 missense probably benign 0.25
IGL02894:Celsr2 APN 3 108395210 missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108412940 missense probably damaging 1.00
goldeneye UTSW 3 108394919 missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108400838 missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108412499 missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108413402 missense probably benign 0.19
R0031:Celsr2 UTSW 3 108413063 missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0090:Celsr2 UTSW 3 108393327 splice site probably benign
R0140:Celsr2 UTSW 3 108397933 missense probably benign 0.00
R0524:Celsr2 UTSW 3 108401587 missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108403895 critical splice donor site probably null
R0662:Celsr2 UTSW 3 108398520 missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108414977 missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108412623 missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108412712 missense probably benign 0.42
R0730:Celsr2 UTSW 3 108398606 missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108401301 missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108414338 missense probably benign
R0989:Celsr2 UTSW 3 108403272 missense probably benign 0.00
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108393739 missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108402483 missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108413520 missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108414095 missense probably benign
R1689:Celsr2 UTSW 3 108407304 missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108401310 missense probably benign 0.35
R1859:Celsr2 UTSW 3 108396630 missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108398650 missense probably benign 0.05
R1974:Celsr2 UTSW 3 108414214 missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108402495 missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108413193 missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108398605 missense probably benign 0.16
R2434:Celsr2 UTSW 3 108404479 missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108413591 missense probably benign 0.11
R3420:Celsr2 UTSW 3 108414416 missense probably benign 0.03
R3712:Celsr2 UTSW 3 108400839 missense probably benign
R3723:Celsr2 UTSW 3 108397415 splice site probably benign
R3809:Celsr2 UTSW 3 108403239 missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108394965 missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108402097 missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108413978 missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108413772 missense probably benign 0.02
R4293:Celsr2 UTSW 3 108393677 missense probably benign 0.01
R4458:Celsr2 UTSW 3 108394997 missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108395216 missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108395969 missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108397231 missense probably benign 0.24
R4732:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108406987 missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108402758 missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108412629 missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108412358 missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108413373 missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108393996 missense probably benign 0.05
R5120:Celsr2 UTSW 3 108393120 missense probably benign 0.02
R5135:Celsr2 UTSW 3 108398659 missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108397630 missense probably benign 0.34
R5381:Celsr2 UTSW 3 108402757 missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108399995 missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108392658 missense probably benign 0.01
R5528:Celsr2 UTSW 3 108413294 missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108402803 missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108396735 missense probably null 0.49
R5697:Celsr2 UTSW 3 108403921 nonsense probably null
R5718:Celsr2 UTSW 3 108393358 missense probably benign
R5869:Celsr2 UTSW 3 108413909 missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108413943 missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108401245 missense probably benign
R6054:Celsr2 UTSW 3 108406963 missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108393128 missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108401214 missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108412574 missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108394919 missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108400501 critical splice donor site probably null
X0020:Celsr2 UTSW 3 108396110 missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108401272 missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108414117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGAAAGTCGTGCCCAAC -3'
(R):5'- AGAAGCGTTATGTGGTCCAG -3'

Sequencing Primer
(F):5'- CTATACTCGAGGCGGGCGTTATC -3'
(R):5'- AGTTCTCCGAGTCACCGC -3'
Posted On2016-06-09