Incidental Mutation 'IGL02799:Gars'
ID392267
Institutional Source Beutler Lab
Gene Symbol Gars
Ensembl Gene ENSMUSG00000029777
Gene Nameglycyl-tRNA synthetase
SynonymsGENA202, Sgrp23, Gena201
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL02799 (G1)
Quality Score201
Status Validated
Chromosome6
Chromosomal Location55038007-55079500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55063099 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 337 (T337K)
Ref Sequence ENSEMBL: ENSMUSP00000003572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003572]
Predicted Effect probably damaging
Transcript: ENSMUST00000003572
AA Change: T337K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003572
Gene: ENSMUSG00000029777
AA Change: T337K

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
WHEP-TRS 57 112 1.58e-8 SMART
Pfam:tRNA-synt_2b 281 582 2.1e-10 PFAM
Pfam:HGTP_anticodon 605 699 7.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203334
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glycyl-tRNA synthetase, one of the aminoacyl-tRNA synthetases that charge tRNAs with their cognate amino acids. The encoded enzyme is an (alpha)2 dimer which belongs to the class II family of tRNA synthetases. It has been shown to be a target of autoantibodies in the human autoimmune diseases, polymyositis or dermatomyositis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: A dominant mutation results in sensory and motor axon degeneration in affected mice, with defects in synaptic transmission, nerve conduction and premature death. A loss of function mutation results in embryonic lethality in homozygous mice, and no discernable phenotype in heterozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 A G 6: 86,106,252 N444S possibly damaging Het
Atp2b2 A T 6: 113,762,852 Y823* probably null Het
Atp2c1 A C 9: 105,413,043 probably benign Het
Capns1 A T 7: 30,192,219 D133E probably benign Het
Cast A G 13: 74,736,752 V361A probably damaging Het
Cd69 G A 6: 129,268,260 probably benign Het
Celsr2 T A 3: 108,414,062 D478V probably damaging Het
Cenpf T C 1: 189,659,652 E661G probably damaging Het
Chrna1 A G 2: 73,574,641 probably benign Het
Clec5a C A 6: 40,578,049 V138F probably damaging Het
Ctsj T A 13: 61,003,820 I95F probably benign Het
Dcaf1 T A 9: 106,857,940 S696T probably benign Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnajc14 C T 10: 128,806,856 P216S possibly damaging Het
Dst T C 1: 34,179,849 I1790T possibly damaging Het
Ehmt1 A T 2: 24,815,806 H789Q probably damaging Het
Exoc7 A T 11: 116,301,181 L188Q probably damaging Het
Faap100 A G 11: 120,370,735 L823P probably damaging Het
Fdxacb1 T A 9: 50,772,596 S620T probably benign Het
Fhl2 C T 1: 43,128,402 R177Q probably benign Het
Ggta1 A T 2: 35,422,199 F56I probably damaging Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gpr108 T A 17: 57,237,482 I343F probably damaging Het
Gpr12 T A 5: 146,583,819 I98F possibly damaging Het
Hk2 A G 6: 82,760,238 L3P probably damaging Het
Imp4 C A 1: 34,440,177 probably benign Het
Insrr G A 3: 87,813,581 V1049M probably damaging Het
Klhl24 T C 16: 20,114,581 V314A probably damaging Het
Krt32 A T 11: 100,087,907 V107D possibly damaging Het
Krtap5-1 G A 7: 142,296,505 Q189* probably null Het
Lrrc9 A G 12: 72,506,404 E1360G probably damaging Het
Mdc1 G T 17: 35,846,191 L163F possibly damaging Het
Mroh1 T G 15: 76,392,461 probably null Het
Myh8 A G 11: 67,301,592 probably benign Het
Ndufab1 A T 7: 122,093,726 probably benign Het
Nek3 A G 8: 22,158,719 probably benign Het
Ngly1 A T 14: 16,260,636 I107L probably benign Het
Nkain4 A T 2: 180,935,935 probably null Het
Nsd2 T A 5: 33,864,788 probably benign Het
Olfr1094 A T 2: 86,828,956 H68L probably damaging Het
Olfr513 A T 7: 108,755,623 M256L probably benign Het
Olfr732 A G 14: 50,281,344 I303T probably benign Het
Olfr857 T A 9: 19,713,018 Y64N probably damaging Het
Olfr874 T A 9: 37,746,509 I125N probably damaging Het
Pcnt G A 10: 76,412,583 Q901* probably null Het
Pctp C A 11: 89,991,087 W81C probably damaging Het
Pik3r5 A T 11: 68,495,947 I801F probably damaging Het
Ptprj A T 2: 90,469,598 N193K probably benign Het
Rab11fip1 A T 8: 27,152,760 D670E probably benign Het
Racgap1 T C 15: 99,632,747 K201E probably benign Het
Ranbp2 T C 10: 58,480,264 F2269L probably damaging Het
Rint1 C A 5: 23,819,480 A760D possibly damaging Het
Ryr2 G A 13: 11,665,962 P3166S probably damaging Het
Snap29 A G 16: 17,422,503 N158D probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
St6galnac1 G T 11: 116,766,647 probably benign Het
Strc G A 2: 121,379,236 T202I probably damaging Het
Stxbp4 A G 11: 90,494,600 probably null Het
Syne1 A T 10: 5,359,059 M650K probably damaging Het
Tbc1d2b C T 9: 90,223,434 probably benign Het
Tcfl5 A T 2: 180,638,626 I328N possibly damaging Het
Tenm2 A G 11: 36,273,408 Y337H probably damaging Het
Tgfbr2 T C 9: 116,110,136 K233E possibly damaging Het
Tnk2 T C 16: 32,665,881 probably benign Het
Trbv13-2 A G 6: 41,121,537 probably benign Het
Usp6nl T A 2: 6,427,549 probably benign Het
Vmn2r62 A G 7: 42,787,972 S363P possibly damaging Het
Vnn3 T C 10: 23,851,971 I93T possibly damaging Het
Ylpm1 A G 12: 85,044,484 D1108G probably damaging Het
Zbtb17 G A 4: 141,463,380 G170S probably benign Het
Zcchc11 T C 4: 108,513,528 Y875H probably benign Het
Zfyve26 T C 12: 79,273,310 E1087G probably benign Het
Other mutations in Gars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Gars APN 6 55050353 missense probably damaging 1.00
IGL01084:Gars APN 6 55055827 missense probably benign
IGL01514:Gars APN 6 55065520 missense probably benign 0.01
IGL02104:Gars APN 6 55077697 missense probably damaging 1.00
IGL02349:Gars APN 6 55048064 splice site probably benign
IGL02371:Gars APN 6 55065467 missense probably benign 0.08
IGL02932:Gars APN 6 55060944 missense probably damaging 1.00
R0637:Gars UTSW 6 55069487 critical splice donor site probably null
R0762:Gars UTSW 6 55077580 splice site probably null
R1451:Gars UTSW 6 55053123 splice site probably benign
R1846:Gars UTSW 6 55063168 missense probably benign 0.05
R1988:Gars UTSW 6 55077772 missense probably null 0.00
R2033:Gars UTSW 6 55077723 missense probably benign 0.02
R2566:Gars UTSW 6 55065563 missense probably damaging 1.00
R4706:Gars UTSW 6 55069378 missense probably damaging 0.99
R4854:Gars UTSW 6 55046418 missense probably damaging 0.99
R5055:Gars UTSW 6 55068092 missense probably damaging 1.00
R5558:Gars UTSW 6 55065607 missense probably damaging 1.00
R6306:Gars UTSW 6 55055824 missense probably damaging 1.00
R6821:Gars UTSW 6 55079338 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCTTGTCTACTAGGCCAG -3'
(R):5'- CAGCTCCCTGAGAACCTTAC -3'

Sequencing Primer
(F):5'- CAGCTTGTCTACTAGGCCAGTTATTG -3'
(R):5'- TGAGAACCTTACCTGTTCAACAG -3'
Posted On2016-06-09