Incidental Mutation 'R5101:Cntnap5a'
ID392336
Institutional Source Beutler Lab
Gene Symbol Cntnap5a
Ensembl Gene ENSMUSG00000070695
Gene Namecontactin associated protein-like 5A
SynonymsCaspr5-1
MMRRC Submission 042852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R5101 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location115684756-116587323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116442296 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 881 (T881I)
Ref Sequence ENSEMBL: ENSMUSP00000035732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043725]
Predicted Effect probably benign
Transcript: ENSMUST00000043725
AA Change: T881I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000035732
Gene: ENSMUSG00000070695
AA Change: T881I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 33 174 1.63e-13 SMART
LamG 201 338 1.4e-26 SMART
LamG 388 522 1.5e-26 SMART
EGF 550 584 2.16e-1 SMART
Blast:FBG 587 772 2e-81 BLAST
LamG 812 939 1.54e-28 SMART
EGF 960 996 2.28e0 SMART
LamG 1037 1173 4.73e-15 SMART
transmembrane domain 1241 1263 N/A INTRINSIC
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,336 E921G possibly damaging Het
Adam17 T C 12: 21,373,405 T10A possibly damaging Het
Adgrg3 T C 8: 95,036,935 F288S probably benign Het
Ago2 A G 15: 73,119,490 V533A probably damaging Het
Akap9 T G 5: 4,001,748 V1505G probably damaging Het
Apob T C 12: 8,011,934 I3439T probably benign Het
C1qtnf7 T A 5: 43,615,972 Y204* probably null Het
Cdc42bpb T C 12: 111,299,115 E1461G probably damaging Het
Cdh3 C T 8: 106,541,392 A353V possibly damaging Het
Clec4d A G 6: 123,267,112 Y60C probably damaging Het
Cmya5 T A 13: 93,091,603 T2326S possibly damaging Het
Cnot1 G A 8: 95,760,187 L631F possibly damaging Het
Col6a1 T A 10: 76,709,906 T911S unknown Het
Ctsw A G 19: 5,465,675 V287A probably benign Het
Cyp2c23 T C 19: 44,029,183 E2G unknown Het
Cytip A T 2: 58,147,899 I151N probably damaging Het
Dnah10 A G 5: 124,832,513 T4399A possibly damaging Het
Dock3 A T 9: 106,969,781 I883N probably damaging Het
Entpd3 A G 9: 120,566,542 *530W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8989 T C 7: 106,329,889 noncoding transcript Het
Gp1ba G A 11: 70,641,399 V664M probably benign Het
Gpd2 T A 2: 57,355,901 I481N probably damaging Het
Ildr2 A G 1: 166,307,762 D342G probably damaging Het
Krt83 A G 15: 101,487,510 I327T probably benign Het
Lats1 T A 10: 7,712,584 C988* probably null Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mast4 T C 13: 102,736,356 D2168G probably benign Het
Myo6 G T 9: 80,270,039 E606* probably null Het
Nek7 A G 1: 138,515,693 V174A probably benign Het
Nid1 T A 13: 13,483,754 C695S probably damaging Het
Nme8 A G 13: 19,690,847 probably null Het
Nr2c2 T C 6: 92,154,516 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1013 A G 2: 85,769,924 N41S probably damaging Het
Olfr1265 A G 2: 90,037,047 M43V probably benign Het
Olfr613 G A 7: 103,551,943 E53K probably damaging Het
Olfr700 A T 7: 106,806,213 I83K possibly damaging Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Psapl1 T A 5: 36,204,150 C29S probably damaging Het
Scn3a A T 2: 65,461,506 V1632D probably damaging Het
Slc22a1 C T 17: 12,667,242 G168D probably damaging Het
Smad4 A G 18: 73,675,860 V112A probably benign Het
Smc4 T C 3: 69,028,512 V796A probably benign Het
Smco4 A G 9: 15,544,672 E18G unknown Het
Sugp2 A G 8: 70,260,489 E1035G probably damaging Het
Syde2 T C 3: 146,015,638 S820P probably damaging Het
Syn2 T C 6: 115,263,899 L410P probably damaging Het
Tmem131l T C 3: 83,937,504 N466S probably damaging Het
Uba1y T G Y: 821,447 probably null Het
Unc79 T C 12: 103,112,510 S1645P probably damaging Het
Vmn2r17 A T 5: 109,428,351 S363C probably damaging Het
Vmn2r78 T C 7: 86,922,355 Y458H probably damaging Het
Other mutations in Cntnap5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Cntnap5a APN 1 116117677 missense possibly damaging 0.48
IGL00929:Cntnap5a APN 1 116060274 splice site probably null
IGL00959:Cntnap5a APN 1 116184327 missense probably benign 0.00
IGL01721:Cntnap5a APN 1 116157637 missense probably benign
IGL02009:Cntnap5a APN 1 116157494 missense probably benign 0.15
IGL02111:Cntnap5a APN 1 116089352 missense probably benign 0.00
IGL02198:Cntnap5a APN 1 116580532 missense probably benign
IGL02751:Cntnap5a APN 1 116184457 critical splice donor site probably null
IGL02752:Cntnap5a APN 1 116580531 missense probably benign 0.00
IGL02989:Cntnap5a APN 1 116412083 splice site probably benign
IGL03195:Cntnap5a APN 1 116157448 missense probably benign 0.00
PIT4142001:Cntnap5a UTSW 1 115684956 start gained probably benign
R0294:Cntnap5a UTSW 1 115915316 missense probably benign
R0377:Cntnap5a UTSW 1 116292529 missense probably benign 0.04
R0597:Cntnap5a UTSW 1 116184461 splice site probably benign
R0616:Cntnap5a UTSW 1 116580549 missense possibly damaging 0.80
R0725:Cntnap5a UTSW 1 116292476 missense probably benign 0.25
R0842:Cntnap5a UTSW 1 116442223 missense probably damaging 0.96
R1103:Cntnap5a UTSW 1 116580669 missense possibly damaging 0.81
R1265:Cntnap5a UTSW 1 116428518 missense possibly damaging 0.49
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1474:Cntnap5a UTSW 1 116442373 nonsense probably null
R1476:Cntnap5a UTSW 1 115901020 missense probably damaging 1.00
R1481:Cntnap5a UTSW 1 116117663 missense probably damaging 1.00
R1512:Cntnap5a UTSW 1 115900950 missense probably benign
R1526:Cntnap5a UTSW 1 116428477 missense probably benign
R1589:Cntnap5a UTSW 1 116060200 missense possibly damaging 0.77
R1603:Cntnap5a UTSW 1 116412101 missense possibly damaging 0.80
R1728:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1729:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1730:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1739:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1762:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1783:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1785:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1816:Cntnap5a UTSW 1 116428888 missense probably benign 0.19
R1872:Cntnap5a UTSW 1 116089210 missense probably benign 0.02
R2095:Cntnap5a UTSW 1 116442260 missense probably damaging 1.00
R2113:Cntnap5a UTSW 1 116188365 missense probably damaging 0.98
R2144:Cntnap5a UTSW 1 116101710 missense probably benign 0.14
R2171:Cntnap5a UTSW 1 116188402 missense possibly damaging 0.95
R2219:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2220:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2571:Cntnap5a UTSW 1 116184362 missense probably damaging 1.00
R3019:Cntnap5a UTSW 1 116101569 missense probably benign
R3827:Cntnap5a UTSW 1 116117679 missense probably benign 0.14
R3870:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R3871:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R4041:Cntnap5a UTSW 1 116184399 missense probably benign 0.00
R4080:Cntnap5a UTSW 1 116101574 missense probably benign 0.01
R4260:Cntnap5a UTSW 1 116446595 missense probably benign 0.31
R4685:Cntnap5a UTSW 1 116446680 missense possibly damaging 0.69
R4781:Cntnap5a UTSW 1 116412201 missense possibly damaging 0.88
R4785:Cntnap5a UTSW 1 116101565 missense probably benign 0.00
R5057:Cntnap5a UTSW 1 115685213 missense probably benign 0.10
R5059:Cntnap5a UTSW 1 116428494 missense probably benign 0.44
R5302:Cntnap5a UTSW 1 116157570 missense probably benign 0.15
R5451:Cntnap5a UTSW 1 115685143 missense probably benign
R5473:Cntnap5a UTSW 1 116089256 missense probably benign 0.12
R5886:Cntnap5a UTSW 1 116571672 critical splice donor site probably null
R6311:Cntnap5a UTSW 1 116412106 nonsense probably null
R6464:Cntnap5a UTSW 1 116184408 missense probably benign
R6497:Cntnap5a UTSW 1 116577897 missense probably damaging 1.00
R6781:Cntnap5a UTSW 1 116292397 missense probably benign 0.05
Z1088:Cntnap5a UTSW 1 116060251 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CAGAAATGCCCTCTGTATGTTG -3'
(R):5'- CCTTGAGTTAGAGAACAAAGCAATC -3'

Sequencing Primer
(F):5'- TGACAGAGAGATATATTCCCTTTCAG -3'
(R):5'- CAAAGCAATCTTGTAGGTACTTAGC -3'
Posted On2016-06-15