Incidental Mutation 'R5101:Syde2'
ID392346
Institutional Source Beutler Lab
Gene Symbol Syde2
Ensembl Gene ENSMUSG00000036863
Gene Namesynapse defective 1, Rho GTPase, homolog 2 (C. elegans)
SynonymsC430017H16Rik
MMRRC Submission 042852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5101 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location145987870-146021720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146015638 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 820 (S820P)
Ref Sequence ENSEMBL: ENSMUSP00000148542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039517] [ENSMUST00000200546] [ENSMUST00000212479]
Predicted Effect probably damaging
Transcript: ENSMUST00000039517
AA Change: S1087P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041897
Gene: ENSMUSG00000036863
AA Change: S1087P

DomainStartEndE-ValueType
low complexity region 65 98 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
low complexity region 197 221 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
C2 802 902 1.1e0 SMART
RhoGAP 950 1149 1.23e-57 SMART
Blast:RhoGAP 1151 1299 2e-50 BLAST
low complexity region 1300 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200546
AA Change: S819P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142954
Gene: ENSMUSG00000036863
AA Change: S819P

DomainStartEndE-ValueType
low complexity region 355 368 N/A INTRINSIC
C2 534 634 7.2e-3 SMART
RhoGAP 682 881 7.3e-60 SMART
Blast:RhoGAP 883 1031 2e-50 BLAST
low complexity region 1032 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212479
AA Change: S820P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,336 E921G possibly damaging Het
Adam17 T C 12: 21,373,405 T10A possibly damaging Het
Adgrg3 T C 8: 95,036,935 F288S probably benign Het
Ago2 A G 15: 73,119,490 V533A probably damaging Het
Akap9 T G 5: 4,001,748 V1505G probably damaging Het
Apob T C 12: 8,011,934 I3439T probably benign Het
C1qtnf7 T A 5: 43,615,972 Y204* probably null Het
Cdc42bpb T C 12: 111,299,115 E1461G probably damaging Het
Cdh3 C T 8: 106,541,392 A353V possibly damaging Het
Clec4d A G 6: 123,267,112 Y60C probably damaging Het
Cmya5 T A 13: 93,091,603 T2326S possibly damaging Het
Cnot1 G A 8: 95,760,187 L631F possibly damaging Het
Cntnap5a C T 1: 116,442,296 T881I probably benign Het
Col6a1 T A 10: 76,709,906 T911S unknown Het
Ctsw A G 19: 5,465,675 V287A probably benign Het
Cyp2c23 T C 19: 44,029,183 E2G unknown Het
Cytip A T 2: 58,147,899 I151N probably damaging Het
Dnah10 A G 5: 124,832,513 T4399A possibly damaging Het
Dock3 A T 9: 106,969,781 I883N probably damaging Het
Entpd3 A G 9: 120,566,542 *530W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8989 T C 7: 106,329,889 noncoding transcript Het
Gp1ba G A 11: 70,641,399 V664M probably benign Het
Gpd2 T A 2: 57,355,901 I481N probably damaging Het
Ildr2 A G 1: 166,307,762 D342G probably damaging Het
Krt83 A G 15: 101,487,510 I327T probably benign Het
Lats1 T A 10: 7,712,584 C988* probably null Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mast4 T C 13: 102,736,356 D2168G probably benign Het
Myo6 G T 9: 80,270,039 E606* probably null Het
Nek7 A G 1: 138,515,693 V174A probably benign Het
Nid1 T A 13: 13,483,754 C695S probably damaging Het
Nme8 A G 13: 19,690,847 probably null Het
Nr2c2 T C 6: 92,154,516 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1013 A G 2: 85,769,924 N41S probably damaging Het
Olfr1265 A G 2: 90,037,047 M43V probably benign Het
Olfr613 G A 7: 103,551,943 E53K probably damaging Het
Olfr700 A T 7: 106,806,213 I83K possibly damaging Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Psapl1 T A 5: 36,204,150 C29S probably damaging Het
Scn3a A T 2: 65,461,506 V1632D probably damaging Het
Slc22a1 C T 17: 12,667,242 G168D probably damaging Het
Smad4 A G 18: 73,675,860 V112A probably benign Het
Smc4 T C 3: 69,028,512 V796A probably benign Het
Smco4 A G 9: 15,544,672 E18G unknown Het
Sugp2 A G 8: 70,260,489 E1035G probably damaging Het
Syn2 T C 6: 115,263,899 L410P probably damaging Het
Tmem131l T C 3: 83,937,504 N466S probably damaging Het
Uba1y T G Y: 821,447 probably null Het
Unc79 T C 12: 103,112,510 S1645P probably damaging Het
Vmn2r17 A T 5: 109,428,351 S363C probably damaging Het
Vmn2r78 T C 7: 86,922,355 Y458H probably damaging Het
Other mutations in Syde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Syde2 APN 3 146014341 missense possibly damaging 0.76
IGL01624:Syde2 APN 3 146007035 missense probably damaging 1.00
IGL02059:Syde2 APN 3 146002172 missense possibly damaging 0.77
IGL02195:Syde2 APN 3 146002156 missense probably damaging 1.00
IGL02498:Syde2 APN 3 145998689 missense probably benign 0.08
IGL02609:Syde2 APN 3 145998520 missense probably benign 0.00
IGL02721:Syde2 APN 3 146002004 missense probably damaging 1.00
IGL02932:Syde2 APN 3 146001476 missense possibly damaging 0.79
IGL02957:Syde2 APN 3 145989179 splice site probably benign
R0062:Syde2 UTSW 3 145998753 missense probably benign 0.00
R0062:Syde2 UTSW 3 145998753 missense probably benign 0.00
R0413:Syde2 UTSW 3 146007132 missense probably damaging 1.00
R0505:Syde2 UTSW 3 146014380 missense possibly damaging 0.85
R0535:Syde2 UTSW 3 145989170 critical splice donor site probably null
R0646:Syde2 UTSW 3 146014249 splice site probably null
R1535:Syde2 UTSW 3 146002421 splice site probably benign
R1914:Syde2 UTSW 3 146014316 nonsense probably null
R1915:Syde2 UTSW 3 146014316 nonsense probably null
R1997:Syde2 UTSW 3 145998991 missense probably benign 0.08
R2012:Syde2 UTSW 3 145988408 missense possibly damaging 0.88
R2112:Syde2 UTSW 3 145998486 missense possibly damaging 0.52
R2220:Syde2 UTSW 3 146001958 missense probably benign 0.07
R2990:Syde2 UTSW 3 146001497 missense probably damaging 0.97
R4022:Syde2 UTSW 3 146015725 missense probably benign 0.25
R5077:Syde2 UTSW 3 146002009 missense probably damaging 1.00
R5084:Syde2 UTSW 3 146001409 frame shift probably null
R5084:Syde2 UTSW 3 146001408 nonsense probably null
R5086:Syde2 UTSW 3 146001408 nonsense probably null
R5087:Syde2 UTSW 3 146001408 nonsense probably null
R5087:Syde2 UTSW 3 146007126 missense probably damaging 1.00
R5211:Syde2 UTSW 3 146001338 missense probably benign 0.01
R5842:Syde2 UTSW 3 145999020 missense probably benign 0.00
R6025:Syde2 UTSW 3 146007141 splice site probably null
R6352:Syde2 UTSW 3 145998474 nonsense probably null
R6384:Syde2 UTSW 3 145998813 missense probably damaging 1.00
R6769:Syde2 UTSW 3 145999048 missense probably damaging 0.98
R6771:Syde2 UTSW 3 145999048 missense probably damaging 0.98
R6970:Syde2 UTSW 3 145988626 missense probably benign 0.15
R6988:Syde2 UTSW 3 146019809 missense probably benign 0.31
R7067:Syde2 UTSW 3 145988264 missense probably benign 0.00
R7146:Syde2 UTSW 3 146007115 nonsense probably null
R7191:Syde2 UTSW 3 146002358 missense probably benign 0.04
R7246:Syde2 UTSW 3 145988755 missense probably benign 0.22
R7271:Syde2 UTSW 3 146020276 missense possibly damaging 0.71
R7307:Syde2 UTSW 3 146015798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCACATTGCCACAGCTG -3'
(R):5'- AAGAAATGTACTCCAGAGAATCCTC -3'

Sequencing Primer
(F):5'- ACATTGCCACAGCTGCTGTTG -3'
(R):5'- GAGAATCCTCTACCTGGCCAGAG -3'
Posted On2016-06-15