Incidental Mutation 'R5101:Cnot1'
ID392362
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene NameCCR4-NOT transcription complex, subunit 1
Synonyms6030411K04Rik
MMRRC Submission 042852-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5101 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95719451-95807464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95760187 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 631 (L631F)
Ref Sequence ENSEMBL: ENSMUSP00000148735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068452
AA Change: L631F

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: L631F

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083277
Predicted Effect possibly damaging
Transcript: ENSMUST00000098473
AA Change: L631F

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: L631F

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196326
Predicted Effect possibly damaging
Transcript: ENSMUST00000211887
AA Change: L629F

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211937
Predicted Effect unknown
Transcript: ENSMUST00000211973
AA Change: L99F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212556
Predicted Effect possibly damaging
Transcript: ENSMUST00000213006
AA Change: L631F

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000213046
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,336 E921G possibly damaging Het
Adam17 T C 12: 21,373,405 T10A possibly damaging Het
Adgrg3 T C 8: 95,036,935 F288S probably benign Het
Ago2 A G 15: 73,119,490 V533A probably damaging Het
Akap9 T G 5: 4,001,748 V1505G probably damaging Het
Apob T C 12: 8,011,934 I3439T probably benign Het
C1qtnf7 T A 5: 43,615,972 Y204* probably null Het
Cdc42bpb T C 12: 111,299,115 E1461G probably damaging Het
Cdh3 C T 8: 106,541,392 A353V possibly damaging Het
Clec4d A G 6: 123,267,112 Y60C probably damaging Het
Cmya5 T A 13: 93,091,603 T2326S possibly damaging Het
Cntnap5a C T 1: 116,442,296 T881I probably benign Het
Col6a1 T A 10: 76,709,906 T911S unknown Het
Ctsw A G 19: 5,465,675 V287A probably benign Het
Cyp2c23 T C 19: 44,029,183 E2G unknown Het
Cytip A T 2: 58,147,899 I151N probably damaging Het
Dnah10 A G 5: 124,832,513 T4399A possibly damaging Het
Dock3 A T 9: 106,969,781 I883N probably damaging Het
Entpd3 A G 9: 120,566,542 *530W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8989 T C 7: 106,329,889 noncoding transcript Het
Gp1ba G A 11: 70,641,399 V664M probably benign Het
Gpd2 T A 2: 57,355,901 I481N probably damaging Het
Ildr2 A G 1: 166,307,762 D342G probably damaging Het
Krt83 A G 15: 101,487,510 I327T probably benign Het
Lats1 T A 10: 7,712,584 C988* probably null Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mast4 T C 13: 102,736,356 D2168G probably benign Het
Myo6 G T 9: 80,270,039 E606* probably null Het
Nek7 A G 1: 138,515,693 V174A probably benign Het
Nid1 T A 13: 13,483,754 C695S probably damaging Het
Nme8 A G 13: 19,690,847 probably null Het
Nr2c2 T C 6: 92,154,516 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1013 A G 2: 85,769,924 N41S probably damaging Het
Olfr1265 A G 2: 90,037,047 M43V probably benign Het
Olfr613 G A 7: 103,551,943 E53K probably damaging Het
Olfr700 A T 7: 106,806,213 I83K possibly damaging Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Psapl1 T A 5: 36,204,150 C29S probably damaging Het
Scn3a A T 2: 65,461,506 V1632D probably damaging Het
Slc22a1 C T 17: 12,667,242 G168D probably damaging Het
Smad4 A G 18: 73,675,860 V112A probably benign Het
Smc4 T C 3: 69,028,512 V796A probably benign Het
Smco4 A G 9: 15,544,672 E18G unknown Het
Sugp2 A G 8: 70,260,489 E1035G probably damaging Het
Syde2 T C 3: 146,015,638 S820P probably damaging Het
Syn2 T C 6: 115,263,899 L410P probably damaging Het
Tmem131l T C 3: 83,937,504 N466S probably damaging Het
Uba1y T G Y: 821,447 probably null Het
Unc79 T C 12: 103,112,510 S1645P probably damaging Het
Vmn2r17 A T 5: 109,428,351 S363C probably damaging Het
Vmn2r78 T C 7: 86,922,355 Y458H probably damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
Xiao UTSW 8 95730420 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGGCCTCAAAATTCATAATGATCC -3'
(R):5'- TGACCTGGTACATGCTAGGC -3'

Sequencing Primer
(F):5'- GATCCATCAGTGTCTACCTCCTGAG -3'
(R):5'- GACCTGGTACATGCTAGGCAATATC -3'
Posted On2016-06-15