Mutagenetix > Incidental Mutation

Incidental Mutation 'R0442:Sstr3'

39240

Institutional Source

Beutler Lab

Gene Symbol

Sstr3

Ensembl Gene

ENSMUSG00000044933

Gene Name

somatostatin receptor 3

Synonyms

Smstr-3, Smstr3, sst3

MMRRC Submission

038643-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0442 (G1)

Quality Score

159

Status

Validated

Chromosome

Chromosomal Location

78421208-78428885 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 78424597 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 50 (L50Q)

Ref Sequence

ENSEMBL: ENSMUSP00000155582 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053239] [ENSMUST00000230400]

AlphaFold

P30935

Predicted Effect

probably damaging
Transcript: ENSMUST00000053239
AA Change: L50Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000058040
Gene: ENSMUSG00000044933
AA Change: L50Q

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	53	291	1.9e-8	PFAM
Pfam:7TM_GPCR_Srsx	56	337	3.5e-15	PFAM
Pfam:7tm_1	62	322	6.3e-60	PFAM
Pfam:7TM_GPCR_Srv	121	337	9.5e-8	PFAM
coiled coil region	355	388	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000230400
AA Change: L50Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Meta Mutation Damage Score

0.2465

Coding Region Coverage

1x: 98.8%
3x: 97.5%
10x: 93.4%
20x: 81.2%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	T	A	1: 25,435,551 (GRCm39)	N816Y	probably damaging	Het
Arfgef3	T	C	10: 18,553,563 (GRCm39)		probably benign	Het
Cd200	T	A	16: 45,217,518 (GRCm39)	S58C	probably damaging	Het
Cep128	C	T	12: 91,233,545 (GRCm39)	E508K	probably damaging	Het
Dnah2	C	A	11: 69,339,368 (GRCm39)	L3046F	probably damaging	Het
Duox2	T	C	2: 122,119,813 (GRCm39)	N872D	probably benign	Het
Fam90a1a	C	T	8: 22,453,074 (GRCm39)	T143I	probably benign	Het
Fdft1	T	C	14: 63,400,798 (GRCm39)	T112A	probably benign	Het
Gimap9	G	T	6: 48,655,000 (GRCm39)	G196*	probably null	Het
Grhl1	G	A	12: 24,662,169 (GRCm39)	R536Q	probably damaging	Het
Gtpbp3	T	A	8: 71,944,135 (GRCm39)	V293E	probably damaging	Het
Hcn3	A	T	3: 89,058,847 (GRCm39)	F251Y	probably damaging	Het
Hectd4	T	A	5: 121,462,045 (GRCm39)	C971S	possibly damaging	Het
Helz2	T	A	2: 180,874,002 (GRCm39)	D2164V	probably damaging	Het
Hif1an	T	G	19: 44,554,451 (GRCm39)	L188R	probably damaging	Het
Hjurp	GT	GTT	1: 88,194,246 (GRCm39)		probably null	Het
Iqgap3	C	T	3: 88,023,266 (GRCm39)	P519L	probably damaging	Het
Jakmip1	T	G	5: 37,292,897 (GRCm39)		probably null	Het
Klra1	T	C	6: 130,349,835 (GRCm39)	Y201C	probably damaging	Het
Minpp1	T	C	19: 32,471,348 (GRCm39)	F299L	possibly damaging	Het
Myb	A	G	10: 21,002,095 (GRCm39)	S749P	probably benign	Het
Myo3b	T	C	2: 70,069,305 (GRCm39)		probably null	Het
Naip1	T	A	13: 100,581,024 (GRCm39)	R74S	probably benign	Het
Nt5m	A	G	11: 59,765,445 (GRCm39)	T158A	possibly damaging	Het
Obscn	A	T	11: 58,893,000 (GRCm39)		probably benign	Het
Or5af1	T	A	11: 58,722,257 (GRCm39)	Y92*	probably null	Het
Or5b119	T	G	19: 13,457,412 (GRCm39)	D50A	probably damaging	Het
Or6c210	T	C	10: 129,495,693 (GRCm39)	I6T	probably benign	Het
Otogl	T	A	10: 107,712,716 (GRCm39)	T543S	probably damaging	Het
Pds5b	T	C	5: 150,640,009 (GRCm39)		probably benign	Het
Plekhm1	A	G	11: 103,288,000 (GRCm39)	M49T	possibly damaging	Het
Rabl6	A	T	2: 25,477,534 (GRCm39)	S305R	probably damaging	Het
Rad54b	G	A	4: 11,609,480 (GRCm39)		probably benign	Het
Rad54b	C	A	4: 11,610,362 (GRCm39)	R660S	probably benign	Het
Rexo5	T	C	7: 119,442,508 (GRCm39)	L542P	probably damaging	Het
Rp1	C	T	1: 4,416,970 (GRCm39)	D1381N	probably benign	Het
Scnn1a	T	G	6: 125,316,100 (GRCm39)	M346R	probably damaging	Het
Sirpb1c	A	G	3: 15,856,710 (GRCm39)	I380T	probably benign	Het
Snrnp40	C	G	4: 130,271,836 (GRCm39)		probably null	Het
St3gal6	C	A	16: 58,293,816 (GRCm39)	A238S	probably damaging	Het
St3gal6	G	T	16: 58,293,818 (GRCm39)	A237E	probably damaging	Het
Sun5	T	C	2: 153,712,872 (GRCm39)	D16G	possibly damaging	Het
Svil	A	T	18: 5,046,870 (GRCm39)	T39S	probably damaging	Het
Taar1	A	G	10: 23,796,380 (GRCm39)	Y26C	possibly damaging	Het
Ugt1a1	AT	A	1: 88,140,093 (GRCm39)		probably null	Het
Use1	T	C	8: 71,819,702 (GRCm39)		probably benign	Het
Usp54	T	C	14: 20,657,277 (GRCm39)	Y7C	probably damaging	Het
Zbtb37	A	G	1: 160,859,918 (GRCm39)	F129S	possibly damaging	Het
Zfhx2	T	C	14: 55,304,357 (GRCm39)	H1209R	possibly damaging	Het
Zfp28	T	C	7: 6,397,998 (GRCm39)	L811P	probably damaging	Het
Zfp616	T	C	11: 73,975,321 (GRCm39)	I530T	possibly damaging	Het

Other mutations in Sstr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Sstr3	APN	15	78,424,667 (GRCm39)	missense	probably benign	0.00
R1714:Sstr3	UTSW	15	78,424,473 (GRCm39)	missense	probably damaging	1.00
R1865:Sstr3	UTSW	15	78,424,168 (GRCm39)	missense	probably damaging	1.00
R2008:Sstr3	UTSW	15	78,424,711 (GRCm39)	missense	probably benign	0.14
R2351:Sstr3	UTSW	15	78,424,121 (GRCm39)	missense	probably benign	0.01
R3023:Sstr3	UTSW	15	78,424,187 (GRCm39)	missense	probably damaging	0.99
R3024:Sstr3	UTSW	15	78,424,187 (GRCm39)	missense	probably damaging	0.99
R3770:Sstr3	UTSW	15	78,424,577 (GRCm39)	missense	probably damaging	1.00
R4399:Sstr3	UTSW	15	78,424,324 (GRCm39)	missense	probably damaging	1.00
R4724:Sstr3	UTSW	15	78,423,897 (GRCm39)	nonsense	probably null
R6181:Sstr3	UTSW	15	78,423,661 (GRCm39)	missense	probably benign
R6247:Sstr3	UTSW	15	78,423,788 (GRCm39)	missense	probably damaging	0.99
R7450:Sstr3	UTSW	15	78,424,043 (GRCm39)	missense	probably damaging	1.00
R7578:Sstr3	UTSW	15	78,424,717 (GRCm39)	missense	probably benign
R7793:Sstr3	UTSW	15	78,424,588 (GRCm39)	missense	probably damaging	1.00
R8336:Sstr3	UTSW	15	78,424,693 (GRCm39)	missense	probably damaging	1.00
R9263:Sstr3	UTSW	15	78,423,792 (GRCm39)	missense	probably damaging	1.00
R9264:Sstr3	UTSW	15	78,423,792 (GRCm39)	missense	probably damaging	1.00
R9265:Sstr3	UTSW	15	78,423,792 (GRCm39)	missense	probably damaging	1.00
X0026:Sstr3	UTSW	15	78,423,574 (GRCm39)	missense	possibly damaging	0.57
Z1177:Sstr3	UTSW	15	78,423,503 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGATGAAGGCTGTTCGCCAGG -3'
(R):5'- AGTGGTGTCCAGTGTAGCACAGAG -3'

Sequencing Primer
(F):5'- ACTGGTTGATGCCATCCACG -3'
(R):5'- GCATCTCTGTCACAACTAAACTCTG -3'

Posted On

2013-05-23