Incidental Mutation 'R5102:Nos3'
ID392411
Institutional Source Beutler Lab
Gene Symbol Nos3
Ensembl Gene ENSMUSG00000028978
Gene Namenitric oxide synthase 3, endothelial cell
SynonymseNOS, 2310065A03Rik, ecNOS, Nos-3
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5102 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24364810-24384474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24371627 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 418 (D418G)
Ref Sequence ENSEMBL: ENSMUSP00000110742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030834] [ENSMUST00000115090]
Predicted Effect probably damaging
Transcript: ENSMUST00000030834
AA Change: D418G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030834
Gene: ENSMUSG00000028978
AA Change: D418G

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 118 480 1.7e-183 PFAM
Pfam:Flavodoxin_1 521 697 4.8e-54 PFAM
Pfam:FAD_binding_1 750 978 2.1e-82 PFAM
Pfam:NAD_binding_1 1010 1124 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115090
AA Change: D418G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110742
Gene: ENSMUSG00000028978
AA Change: D418G

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 114 485 9e-214 PFAM
Pfam:Flavodoxin_1 521 697 3.8e-54 PFAM
Pfam:FAD_binding_1 750 978 1.6e-79 PFAM
Pfam:NAD_binding_1 1010 1091 5.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156403
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced survival, hypertension, inhibited basal vasodilation, insulin resistance, fewer mitochondria, reduced heart rate, impaired ovulation and, in some, shortened limbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Nos3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Nos3 APN 5 24369862 missense probably damaging 1.00
IGL02059:Nos3 APN 5 24368998 missense probably damaging 1.00
IGL02354:Nos3 APN 5 24367623 missense probably damaging 1.00
IGL02361:Nos3 APN 5 24367623 missense probably damaging 1.00
IGL02936:Nos3 APN 5 24380993 missense probably damaging 0.97
IGL03190:Nos3 APN 5 24383629 missense probably damaging 1.00
paul UTSW 5 24372704 missense probably damaging 1.00
Peter UTSW 5 24377855 missense probably damaging 0.99
R0111:Nos3 UTSW 5 24372704 missense probably damaging 1.00
R0387:Nos3 UTSW 5 24367585 missense probably damaging 1.00
R0755:Nos3 UTSW 5 24367297 missense probably damaging 1.00
R1156:Nos3 UTSW 5 24377619 missense probably benign 0.21
R1597:Nos3 UTSW 5 24368997 missense probably damaging 1.00
R1671:Nos3 UTSW 5 24383840 missense probably damaging 1.00
R1743:Nos3 UTSW 5 24377312 missense probably benign 0.22
R1830:Nos3 UTSW 5 24370133 missense probably damaging 1.00
R1882:Nos3 UTSW 5 24368820 missense probably damaging 1.00
R2294:Nos3 UTSW 5 24364857 missense probably damaging 0.99
R3114:Nos3 UTSW 5 24372631 splice site probably benign
R3978:Nos3 UTSW 5 24377931 missense probably damaging 1.00
R3980:Nos3 UTSW 5 24377931 missense probably damaging 1.00
R4016:Nos3 UTSW 5 24371716 missense probably damaging 1.00
R4905:Nos3 UTSW 5 24367331 missense probably benign 0.01
R4947:Nos3 UTSW 5 24377855 missense probably damaging 0.99
R5017:Nos3 UTSW 5 24366719 intron probably benign
R5095:Nos3 UTSW 5 24368918 splice site probably benign
R5096:Nos3 UTSW 5 24371957 missense probably damaging 1.00
R5311:Nos3 UTSW 5 24377345 missense probably benign 0.19
R5330:Nos3 UTSW 5 24369904 missense probably damaging 1.00
R5367:Nos3 UTSW 5 24371944 missense probably benign 0.00
R5394:Nos3 UTSW 5 24383890 missense probably benign 0.00
R5574:Nos3 UTSW 5 24368861 missense possibly damaging 0.80
R5889:Nos3 UTSW 5 24368777 intron probably benign
R6032:Nos3 UTSW 5 24379811 missense probably benign
R6032:Nos3 UTSW 5 24379811 missense probably benign
R6401:Nos3 UTSW 5 24379811 missense probably benign
R6517:Nos3 UTSW 5 24383624 missense probably damaging 1.00
R6888:Nos3 UTSW 5 24383335 missense possibly damaging 0.86
R6972:Nos3 UTSW 5 24380243 missense probably benign
R6973:Nos3 UTSW 5 24380243 missense probably benign
R7432:Nos3 UTSW 5 24367615 missense probably damaging 0.98
R7434:Nos3 UTSW 5 24382635 missense probably damaging 0.99
R7507:Nos3 UTSW 5 24372644 missense probably damaging 1.00
R7553:Nos3 UTSW 5 24381717 missense possibly damaging 0.62
X0020:Nos3 UTSW 5 24370124 missense probably damaging 1.00
X0061:Nos3 UTSW 5 24382635 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACCCAAGGCACAGAATAG -3'
(R):5'- ATGGAAGAAAGCAGCTCCTG -3'

Sequencing Primer
(F):5'- GCACAGAATAGACTGGGTTTGC -3'
(R):5'- TGCCCAGACCTGCACTAAGTG -3'
Posted On2016-06-15