Incidental Mutation 'R5102:Plppr3'
ID392431
Institutional Source Beutler Lab
Gene Symbol Plppr3
Ensembl Gene ENSMUSG00000035835
Gene Namephospholipid phosphatase related 3
SynonymsBC005764, Lppr3
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5102 (G1)
Quality Score164
Status Not validated
Chromosome10
Chromosomal Location79860475-79874634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 79865386 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 541 (P541T)
Ref Sequence ENSEMBL: ENSMUSP00000089979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057343] [ENSMUST00000092325] [ENSMUST00000095457] [ENSMUST00000165601] [ENSMUST00000165704] [ENSMUST00000165724] [ENSMUST00000166023] [ENSMUST00000167250] [ENSMUST00000167707] [ENSMUST00000167897] [ENSMUST00000172282]
Predicted Effect probably benign
Transcript: ENSMUST00000057343
SMART Domains Protein: ENSMUSP00000059481
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092325
AA Change: P541T

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089979
Gene: ENSMUSG00000035835
AA Change: P541T

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
coiled coil region 430 460 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095457
SMART Domains Protein: ENSMUSP00000093109
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_6 36 86 1.9e-5 PFAM
Pfam:RRM_5 38 90 3.6e-12 PFAM
low complexity region 121 138 N/A INTRINSIC
RRM 144 213 4.75e-7 SMART
low complexity region 265 290 N/A INTRINSIC
RRM 296 365 1.84e-13 SMART
RRM 413 483 2.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165153
Predicted Effect probably benign
Transcript: ENSMUST00000165601
SMART Domains Protein: ENSMUSP00000128681
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 266 7.27e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165704
SMART Domains Protein: ENSMUSP00000127783
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
RRM 336 405 1.84e-13 SMART
RRM 453 523 2.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165724
SMART Domains Protein: ENSMUSP00000130749
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_5 2 40 5.3e-7 PFAM
low complexity region 114 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166023
SMART Domains Protein: ENSMUSP00000127171
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166593
Predicted Effect probably benign
Transcript: ENSMUST00000167250
SMART Domains Protein: ENSMUSP00000130695
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
low complexity region 437 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167707
SMART Domains Protein: ENSMUSP00000132994
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
Blast:acidPPc 125 159 8e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167897
SMART Domains Protein: ENSMUSP00000127972
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170910
Predicted Effect probably benign
Transcript: ENSMUST00000172282
SMART Domains Protein: ENSMUSP00000126192
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 331 356 N/A INTRINSIC
RRM 362 431 1.84e-13 SMART
RRM 479 549 2.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184090
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteins in the lipid phosphate phosphatase (LPP) family, including PRG2, are integral membrane proteins that modulate bioactive lipid phosphates including phosphatidate, lysophosphatidate, and sphingosine-1-phosphate in the context of cell migration, neurite retraction, and mitogenesis (Brauer et al., 2003 [PubMed 12730698]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Plppr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Plppr3 APN 10 79866669 missense probably damaging 1.00
IGL01108:Plppr3 APN 10 79867521 missense probably damaging 1.00
IGL01116:Plppr3 APN 10 79866923 missense probably damaging 1.00
IGL01362:Plppr3 APN 10 79865961 missense probably damaging 1.00
IGL03065:Plppr3 APN 10 79866046 missense probably benign 0.06
R0972:Plppr3 UTSW 10 79865086 missense probably damaging 0.99
R1508:Plppr3 UTSW 10 79867540 missense probably damaging 1.00
R1844:Plppr3 UTSW 10 79866410 critical splice donor site probably null
R1907:Plppr3 UTSW 10 79874069 missense probably damaging 1.00
R1982:Plppr3 UTSW 10 79866425 missense probably damaging 1.00
R1984:Plppr3 UTSW 10 79867460 nonsense probably null
R1985:Plppr3 UTSW 10 79867460 nonsense probably null
R2116:Plppr3 UTSW 10 79865738 missense probably benign 0.01
R2355:Plppr3 UTSW 10 79865360 missense possibly damaging 0.81
R4092:Plppr3 UTSW 10 79867480 missense probably damaging 1.00
R4572:Plppr3 UTSW 10 79866063 missense probably benign 0.03
R4685:Plppr3 UTSW 10 79867525 missense probably damaging 1.00
R4824:Plppr3 UTSW 10 79865673 missense possibly damaging 0.81
R5212:Plppr3 UTSW 10 79862445 missense probably benign 0.00
R5584:Plppr3 UTSW 10 79866452 missense probably damaging 1.00
R5684:Plppr3 UTSW 10 79865317 missense possibly damaging 0.81
R5778:Plppr3 UTSW 10 79866503 missense possibly damaging 0.78
R5954:Plppr3 UTSW 10 79866126 missense probably benign 0.05
R6306:Plppr3 UTSW 10 79861732 nonsense probably null
R6357:Plppr3 UTSW 10 79865406 missense probably benign 0.06
R7134:Plppr3 UTSW 10 79865703 missense probably damaging 0.96
X0067:Plppr3 UTSW 10 79865284 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CTGTTTACAGCTGCTTCTGAAG -3'
(R):5'- ACTCTACCCTACTGTCCAGG -3'

Sequencing Primer
(F):5'- AGCAGACAGGTGCACCACTG -3'
(R):5'- AGTCATCCTGCCTCCAAGG -3'
Posted On2016-06-15