Incidental Mutation 'R5102:Cbll1'
ID392437
Institutional Source Beutler Lab
Gene Symbol Cbll1
Ensembl Gene ENSMUSG00000020659
Gene NameCasitas B-lineage lymphoma-like 1
Synonymsc-Cbl-like, Hakai
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R5102 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location31484829-31499616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31487913 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 280 (T280N)
Ref Sequence ENSEMBL: ENSMUSP00000141007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064240] [ENSMUST00000085487] [ENSMUST00000101499] [ENSMUST00000185739] [ENSMUST00000188326]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064240
AA Change: T278N

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063266
Gene: ENSMUSG00000020659
AA Change: T278N

DomainStartEndE-ValueType
RING 105 144 1.08e-1 SMART
ZnF_C2H2 160 186 5.92e0 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
low complexity region 292 315 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085487
AA Change: T281N

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082616
Gene: ENSMUSG00000020659
AA Change: T281N

DomainStartEndE-ValueType
RING 109 148 1.08e-1 SMART
ZnF_C2H2 164 190 5.92e0 SMART
low complexity region 207 218 N/A INTRINSIC
low complexity region 231 244 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 376 399 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101499
AA Change: T281N

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099038
Gene: ENSMUSG00000020659
AA Change: T281N

DomainStartEndE-ValueType
RING 109 148 5.3e-4 SMART
ZnF_C2H2 164 190 2.5e-2 SMART
low complexity region 207 218 N/A INTRINSIC
low complexity region 231 244 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
low complexity region 308 320 N/A INTRINSIC
low complexity region 336 360 N/A INTRINSIC
low complexity region 372 388 N/A INTRINSIC
low complexity region 393 426 N/A INTRINSIC
low complexity region 451 474 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185739
AA Change: T280N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141007
Gene: ENSMUSG00000020659
AA Change: T280N

DomainStartEndE-ValueType
RING 108 147 5.2e-4 SMART
ZnF_C2H2 163 189 2.5e-2 SMART
low complexity region 206 217 N/A INTRINSIC
low complexity region 230 243 N/A INTRINSIC
low complexity region 261 273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186876
Predicted Effect probably benign
Transcript: ENSMUST00000188326
SMART Domains Protein: ENSMUSP00000139809
Gene: ENSMUSG00000020659

DomainStartEndE-ValueType
RING 106 145 5.2e-4 SMART
ZnF_C2H2 161 187 2.5e-2 SMART
low complexity region 204 215 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-ligase for the E-cadherin complex and mediates its ubiquitination, endocytosis, and degradation in the lysosomes. The encoded protein contains a RING-finger domain and is also thought to have a role in control of cell proliferation. A related pseudogene has been identified on chromosome X. Alternative splicing results in a non-coding transcript variant. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Cbll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Cbll1 APN 12 31487833 missense probably damaging 0.99
IGL00540:Cbll1 APN 12 31487941 missense probably damaging 1.00
IGL02988:Cbll1 UTSW 12 31492172 missense possibly damaging 0.86
R0398:Cbll1 UTSW 12 31492092 missense probably damaging 0.99
R0573:Cbll1 UTSW 12 31490540 missense probably damaging 1.00
R1536:Cbll1 UTSW 12 31487856 missense probably damaging 1.00
R6267:Cbll1 UTSW 12 31487508 missense probably benign 0.00
R6296:Cbll1 UTSW 12 31487508 missense probably benign 0.00
R6304:Cbll1 UTSW 12 31494589 critical splice donor site probably null
R6882:Cbll1 UTSW 12 31487485 missense probably damaging 1.00
X0028:Cbll1 UTSW 12 31488309 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTTGGCTATATACCAAGTGAGG -3'
(R):5'- ATCGGTTCATAATGCCACCAG -3'

Sequencing Primer
(F):5'- TTGGCTATATACCAAGTGAGGAGTAC -3'
(R):5'- GACAAGCATCATATGAGCCATATTC -3'
Posted On2016-06-15