Incidental Mutation 'R5102:Cdh10'
ID392444
Institutional Source Beutler Lab
Gene Symbol Cdh10
Ensembl Gene ENSMUSG00000022321
Gene Namecadherin 10
SynonymsT2-cadherin, C030003B10Rik, C030011H18Rik, A830016G23Rik
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5102 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location18818947-19014236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18986885 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 401 (T401S)
Ref Sequence ENSEMBL: ENSMUSP00000128782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040562] [ENSMUST00000166873] [ENSMUST00000176146]
Predicted Effect probably benign
Transcript: ENSMUST00000040562
AA Change: T401S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000042199
Gene: ENSMUSG00000022321
AA Change: T401S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
CA 406 487 6.23e-21 SMART
CA 510 594 3.56e-7 SMART
transmembrane domain 612 634 N/A INTRINSIC
Pfam:Cadherin_C 635 782 9.2e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166873
AA Change: T401S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128782
Gene: ENSMUSG00000022321
AA Change: T401S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
CA 406 487 6.23e-21 SMART
CA 510 594 3.56e-7 SMART
transmembrane domain 612 634 N/A INTRINSIC
Pfam:Cadherin_C 637 783 1.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176146
AA Change: T401S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135546
Gene: ENSMUSG00000022321
AA Change: T401S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is expressed in the blood-brain barrier and retinal endothelia suggesting a role in the development and maintenance of brain barrier. Alternative splicing results in multiple transcript variants. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Cdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Cdh10 APN 15 19013263 missense probably damaging 1.00
IGL00540:Cdh10 APN 15 18963995 missense probably damaging 1.00
IGL00769:Cdh10 APN 15 18985099 missense possibly damaging 0.63
IGL00837:Cdh10 APN 15 19013404 missense probably benign
IGL01307:Cdh10 APN 15 18899800 missense probably benign 0.34
IGL01509:Cdh10 APN 15 18986798 missense possibly damaging 0.70
IGL01561:Cdh10 APN 15 18999926 missense possibly damaging 0.52
IGL01743:Cdh10 APN 15 18986769 missense probably benign 0.06
IGL02065:Cdh10 APN 15 19013256 missense probably damaging 1.00
IGL02083:Cdh10 APN 15 18986889 missense possibly damaging 0.79
IGL02238:Cdh10 APN 15 19013519 missense probably damaging 1.00
IGL02838:Cdh10 APN 15 18899763 missense probably damaging 1.00
IGL03397:Cdh10 APN 15 18964028 missense probably damaging 1.00
R0423:Cdh10 UTSW 15 18986879 missense probably benign 0.00
R0828:Cdh10 UTSW 15 18986751 missense possibly damaging 0.52
R1488:Cdh10 UTSW 15 19013263 missense probably damaging 1.00
R1563:Cdh10 UTSW 15 18986767 nonsense probably null
R1674:Cdh10 UTSW 15 18985066 missense probably benign 0.11
R1674:Cdh10 UTSW 15 19013330 missense probably damaging 1.00
R1737:Cdh10 UTSW 15 18964063 missense probably damaging 1.00
R1819:Cdh10 UTSW 15 18991965 nonsense probably null
R1865:Cdh10 UTSW 15 18899604 missense probably benign 0.01
R1953:Cdh10 UTSW 15 18966911 critical splice donor site probably null
R2439:Cdh10 UTSW 15 19013398 missense probably damaging 1.00
R3944:Cdh10 UTSW 15 18964249 missense probably benign
R4320:Cdh10 UTSW 15 18985165 missense probably benign 0.03
R4330:Cdh10 UTSW 15 18999959 missense probably damaging 1.00
R4765:Cdh10 UTSW 15 19013278 missense probably damaging 0.98
R4831:Cdh10 UTSW 15 19013578 missense probably benign 0.10
R5166:Cdh10 UTSW 15 19013360 missense probably damaging 0.99
R5217:Cdh10 UTSW 15 18966022 missense probably damaging 0.98
R5843:Cdh10 UTSW 15 18985200 missense possibly damaging 0.68
R5902:Cdh10 UTSW 15 18985255 critical splice donor site probably null
R6263:Cdh10 UTSW 15 18964068 missense possibly damaging 0.86
R6636:Cdh10 UTSW 15 18985173 missense probably damaging 0.99
R6770:Cdh10 UTSW 15 18985222 missense probably benign 0.09
R7046:Cdh10 UTSW 15 19013201 missense probably damaging 0.98
R7362:Cdh10 UTSW 15 18899694 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCACTTGACTATGAGAACCG -3'
(R):5'- GTGTTGCCCATGACACTCAATG -3'

Sequencing Primer
(F):5'- CCGAAGACTATATACTCTGAAGGTG -3'
(R):5'- TGTTGCCCATGACACTCAATGAAAAC -3'
Posted On2016-06-15