Incidental Mutation 'R5102:Lrp5'
ID392448
Institutional Source Beutler Lab
Gene Symbol Lrp5
Ensembl Gene ENSMUSG00000024913
Gene Namelow density lipoprotein receptor-related protein 5
SynonymsLR3, LRP7
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R5102 (G1)
Quality Score163
Status Not validated
Chromosome19
Chromosomal Location3584828-3686564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3659304 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 142 (K142R)
Ref Sequence ENSEMBL: ENSMUSP00000135654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025856] [ENSMUST00000176867] [ENSMUST00000177330]
Predicted Effect probably damaging
Transcript: ENSMUST00000025856
AA Change: K142R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025856
Gene: ENSMUSG00000024913
AA Change: K142R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
LY 229 270 4e-5 SMART
EGF 297 336 1.01e-1 SMART
LY 364 406 5.15e-8 SMART
LY 407 449 4.12e-16 SMART
LY 450 493 7.68e-16 SMART
LY 494 536 6.24e-16 SMART
LY 537 577 3.73e-5 SMART
EGF 603 640 2.48e-1 SMART
LY 666 708 5.92e-8 SMART
LY 709 751 5.65e-14 SMART
LY 752 795 3.81e-11 SMART
LY 796 837 3.54e-6 SMART
LY 838 877 1.33e-1 SMART
EGF 904 941 1.22e0 SMART
LY 968 1009 4.39e-2 SMART
LY 1015 1057 1.81e0 SMART
LY 1058 1102 9.47e-7 SMART
LY 1103 1145 6.91e-9 SMART
LY 1146 1186 1.53e0 SMART
EGF 1215 1253 2.85e-1 SMART
LDLa 1257 1296 1.23e-13 SMART
LDLa 1297 1333 3.26e-9 SMART
LDLa 1334 1371 1.31e-13 SMART
transmembrane domain 1384 1406 N/A INTRINSIC
low complexity region 1494 1503 N/A INTRINSIC
low complexity region 1571 1578 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176867
AA Change: K142R

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135654
Gene: ENSMUSG00000024913
AA Change: K142R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
LY 229 270 4e-5 SMART
EGF 297 336 1.01e-1 SMART
LY 364 406 5.15e-8 SMART
LY 407 449 4.12e-16 SMART
LY 450 493 7.68e-16 SMART
LY 494 536 6.24e-16 SMART
LY 537 577 3.73e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177330
AA Change: K142R

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134983
Gene: ENSMUSG00000024913
AA Change: K142R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants show variable bone loss, decreased osteoblast proliferation, impaired glucose tolerance, increased plasma cholesterol on high-fat diet and persistent embryonic eye vascularization, depending on allelic combination and strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Lrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Lrp5 APN 19 3649404 missense probably benign
IGL00902:Lrp5 APN 19 3600774 missense probably damaging 1.00
IGL02032:Lrp5 APN 19 3615886 splice site probably benign
IGL02331:Lrp5 APN 19 3591816 missense possibly damaging 0.64
IGL02401:Lrp5 APN 19 3593585 missense probably damaging 1.00
IGL02471:Lrp5 APN 19 3602408 missense probably benign 0.31
IGL02572:Lrp5 APN 19 3614283 missense probably benign 0.17
IGL02637:Lrp5 APN 19 3630269 missense probably benign 0.03
IGL02696:Lrp5 APN 19 3602253 missense probably benign
IGL02742:Lrp5 APN 19 3604022 missense probably damaging 0.99
IGL02804:Lrp5 APN 19 3600777 missense possibly damaging 0.63
IGL03089:Lrp5 APN 19 3620314 splice site probably null
IGL03243:Lrp5 APN 19 3630159 missense probably benign 0.12
r18 UTSW 19 small insertion
PIT4494001:Lrp5 UTSW 19 3610091 missense probably damaging 1.00
R0219:Lrp5 UTSW 19 3597349 missense probably damaging 1.00
R0526:Lrp5 UTSW 19 3628295 missense probably damaging 1.00
R0597:Lrp5 UTSW 19 3600777 missense possibly damaging 0.63
R0883:Lrp5 UTSW 19 3605308 missense probably damaging 1.00
R1086:Lrp5 UTSW 19 3649476 missense probably benign 0.28
R1417:Lrp5 UTSW 19 3586425 missense probably benign 0.04
R1468:Lrp5 UTSW 19 3620191 missense possibly damaging 0.76
R1468:Lrp5 UTSW 19 3620191 missense possibly damaging 0.76
R1533:Lrp5 UTSW 19 3614234 missense probably benign 0.17
R1538:Lrp5 UTSW 19 3647585 missense possibly damaging 0.70
R1856:Lrp5 UTSW 19 3597346 missense probably benign 0.18
R1930:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1931:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1932:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1951:Lrp5 UTSW 19 3620298 missense possibly damaging 0.89
R2016:Lrp5 UTSW 19 3610056 missense probably benign 0.04
R2131:Lrp5 UTSW 19 3622708 missense possibly damaging 0.87
R2153:Lrp5 UTSW 19 3614339 missense probably benign 0.22
R2403:Lrp5 UTSW 19 3597430 missense probably damaging 1.00
R3158:Lrp5 UTSW 19 3615849 missense probably damaging 0.97
R3771:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3772:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3773:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3825:Lrp5 UTSW 19 3605290 nonsense probably null
R3887:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3888:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3893:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3917:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R4279:Lrp5 UTSW 19 3591778 missense possibly damaging 0.94
R4714:Lrp5 UTSW 19 3659454 missense probably damaging 1.00
R4825:Lrp5 UTSW 19 3614292 missense probably damaging 1.00
R5138:Lrp5 UTSW 19 3628319 missense probably benign 0.03
R5497:Lrp5 UTSW 19 3602319 missense probably damaging 1.00
R5632:Lrp5 UTSW 19 3622512 missense probably benign
R5887:Lrp5 UTSW 19 3604094 missense probably benign 0.01
R5950:Lrp5 UTSW 19 3602333 missense probably benign 0.17
R5987:Lrp5 UTSW 19 3628299 missense probably damaging 1.00
R6080:Lrp5 UTSW 19 3628316 missense probably benign 0.32
R6181:Lrp5 UTSW 19 3628427 missense probably damaging 1.00
R6236:Lrp5 UTSW 19 3630483 splice site probably null
R6332:Lrp5 UTSW 19 3659355 missense probably damaging 1.00
R6511:Lrp5 UTSW 19 3652296 missense probably damaging 1.00
R6641:Lrp5 UTSW 19 3652287 missense probably damaging 1.00
R6791:Lrp5 UTSW 19 3600753 missense probably damaging 1.00
R6865:Lrp5 UTSW 19 3620013 critical splice donor site probably null
R6906:Lrp5 UTSW 19 3622638 missense probably damaging 1.00
R6922:Lrp5 UTSW 19 3605301 missense probably damaging 1.00
R7091:Lrp5 UTSW 19 3630184 missense probably damaging 1.00
R7303:Lrp5 UTSW 19 3591774 missense probably damaging 0.99
R7368:Lrp5 UTSW 19 3620085 missense possibly damaging 0.95
R7381:Lrp5 UTSW 19 3593588 missense probably benign 0.20
R7385:Lrp5 UTSW 19 3612197 critical splice donor site probably null
R7392:Lrp5 UTSW 19 3610199 missense probably damaging 1.00
R7448:Lrp5 UTSW 19 3649439 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATCTGGAAGGGAGGTGATTCC -3'
(R):5'- AAGGGTGCTGTGTACTGGAC -3'

Sequencing Primer
(F):5'- GAGGTGATTCCCAGCAAGG -3'
(R):5'- CTGTGTACTGGACAGATGTGAGC -3'
Posted On2016-06-15