Incidental Mutation 'R5103:Tenm4'
ID392483
Institutional Source Beutler Lab
Gene Symbol Tenm4
Ensembl Gene ENSMUSG00000048078
Gene Nameteneurin transmembrane protein 4
SynonymsDoc4, l7Rn3, Ten-m4, ELM2, l(7)-3Rn, Odz4
MMRRC Submission 042691-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5103 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location96171246-96911093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96842957 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1033 (I1033F)
Ref Sequence ENSEMBL: ENSMUSP00000102780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]
Predicted Effect probably damaging
Transcript: ENSMUST00000107162
AA Change: I1033F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: I1033F

DomainStartEndE-ValueType
Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107165
AA Change: I1034F

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: I1034F

DomainStartEndE-ValueType
Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107166
AA Change: I997F

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: I997F

DomainStartEndE-ValueType
Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147659
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,189,262 I591V probably benign Het
Agbl5 G A 5: 30,894,001 R518H probably damaging Het
Agfg1 T C 1: 82,893,567 S486P probably damaging Het
Arhgap18 A G 10: 26,869,982 D283G probably damaging Het
Asb1 A G 1: 91,552,344 N162S possibly damaging Het
BC037034 A G 5: 138,262,300 V288A probably benign Het
Capn1 A G 19: 6,009,110 Y274H probably damaging Het
Cdk5 A T 5: 24,422,835 V30E probably damaging Het
Cep290 T G 10: 100,539,020 L1376W probably damaging Het
Crybg1 T A 10: 43,997,948 T1055S probably damaging Het
Cyp2c70 A G 19: 40,160,632 Y357H probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Eml6 T A 11: 29,850,905 E367V possibly damaging Het
Emp1 A G 6: 135,381,075 T140A probably benign Het
Ergic3 T C 2: 156,008,625 V74A probably benign Het
Fancm A T 12: 65,105,858 L1029F probably damaging Het
Fank1 C A 7: 133,876,841 C210* probably null Het
Fbxo31 T C 8: 121,552,362 D462G probably damaging Het
Frem1 G A 4: 82,991,612 A736V probably benign Het
Fshr T C 17: 89,097,368 T56A possibly damaging Het
Gm5901 A T 7: 105,377,382 probably null Het
Gm8909 T C 17: 36,161,685 probably benign Het
Golga2 A G 2: 32,303,746 E458G probably benign Het
Grik2 T A 10: 49,496,109 I335F probably benign Het
Grin1 T A 2: 25,310,421 M230L probably benign Het
Gtf2f1 C T 17: 57,004,519 G297D probably damaging Het
Hacd1 T C 2: 14,040,913 T136A probably damaging Het
Hdac5 T A 11: 102,196,283 S24C probably damaging Het
Jtb T C 3: 90,232,087 probably benign Het
Kif1a C T 1: 93,046,696 G979E probably damaging Het
Mark2 T C 19: 7,284,503 M345V probably damaging Het
Mfsd14b A G 13: 65,087,093 V90A possibly damaging Het
Micu1 T C 10: 59,788,984 Y283H possibly damaging Het
Mmp2 C T 8: 92,831,785 R161* probably null Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Msh5 T C 17: 35,029,239 I783V possibly damaging Het
Myo3b T A 2: 70,096,403 F65I probably benign Het
Nat10 C A 2: 103,757,260 V37L probably damaging Het
Nlrp1a T A 11: 71,099,526 T967S probably damaging Het
Nolc1 A T 19: 46,081,664 K291* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr347 A T 2: 36,734,668 T116S probably benign Het
Olfr52 C A 2: 86,181,616 R165L probably benign Het
Olfr926 G T 9: 38,877,576 M133I probably damaging Het
Paip1 A G 13: 119,437,979 E70G possibly damaging Het
Palmd T A 3: 116,927,421 E127V probably damaging Het
Paqr6 T A 3: 88,367,717 C262* probably null Het
Pdcd11 A G 19: 47,124,454 H1301R probably benign Het
Plce1 C A 19: 38,767,215 D1896E probably damaging Het
Ppib A G 9: 66,061,465 probably null Het
Pzp C T 6: 128,502,229 V654M probably benign Het
Rab26 T C 17: 24,534,097 probably benign Het
Recql4 A G 15: 76,706,756 L468P probably damaging Het
Retreg1 C T 15: 25,968,454 Q65* probably null Het
Rhpn1 C T 15: 75,714,215 T659I possibly damaging Het
Slc12a5 C A 2: 164,992,433 H791Q probably damaging Het
Slc40a1 G A 1: 45,918,995 Q93* probably null Het
Slc4a1 T C 11: 102,353,261 M681V possibly damaging Het
Slc6a9 T A 4: 117,868,155 F493L probably benign Het
Smc2 A G 4: 52,459,033 E476G probably damaging Het
Smco4 G T 9: 15,544,794 E59* probably null Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stat4 T A 1: 52,071,895 L167Q probably damaging Het
Sult1e1 C A 5: 87,576,232 V289L probably benign Het
Tbc1d4 C A 14: 101,458,882 E877* probably null Het
Tppp2 T A 14: 51,919,452 F95L probably benign Het
Vmn2r41 G A 7: 8,138,342 L708F probably benign Het
Washc5 G A 15: 59,350,169 P126L probably damaging Het
Xkr4 T C 1: 3,670,688 I221V probably benign Het
Xkr5 T C 8: 18,933,643 R628G probably benign Het
Zfp207 T C 11: 80,391,910 L233P probably damaging Het
Zfp827 T A 8: 79,070,403 C373S probably damaging Het
Other mutations in Tenm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Tenm4 APN 7 96868009 missense probably benign 0.00
IGL00468:Tenm4 APN 7 96874472 missense probably damaging 0.98
IGL00519:Tenm4 APN 7 96805138 splice site probably benign
IGL00979:Tenm4 APN 7 96729391 missense probably damaging 0.96
IGL01401:Tenm4 APN 7 96874267 missense probably damaging 1.00
IGL01459:Tenm4 APN 7 96729385 missense probably damaging 1.00
IGL01519:Tenm4 APN 7 96895177 missense probably damaging 1.00
IGL01545:Tenm4 APN 7 96874303 missense probably benign 0.00
IGL01579:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01587:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01625:Tenm4 APN 7 96885358 missense probably damaging 1.00
IGL01655:Tenm4 APN 7 96553724 missense probably damaging 1.00
IGL01683:Tenm4 APN 7 96885404 missense possibly damaging 0.84
IGL01728:Tenm4 APN 7 96896064 missense probably damaging 1.00
IGL01732:Tenm4 APN 7 96895509 missense probably damaging 1.00
IGL01924:Tenm4 APN 7 96895212 missense probably damaging 1.00
IGL01966:Tenm4 APN 7 96553550 missense probably damaging 1.00
IGL02177:Tenm4 APN 7 96895662 missense probably benign 0.40
IGL02207:Tenm4 APN 7 96874116 missense possibly damaging 0.85
IGL02269:Tenm4 APN 7 96823822 missense probably damaging 1.00
IGL02274:Tenm4 APN 7 96854734 missense probably damaging 1.00
IGL02375:Tenm4 APN 7 96704137 missense possibly damaging 0.52
IGL02415:Tenm4 APN 7 96874074 missense probably damaging 0.98
IGL02472:Tenm4 APN 7 96774176 unclassified probably benign
IGL02656:Tenm4 APN 7 96885433 missense probably damaging 1.00
IGL02678:Tenm4 APN 7 96896219 missense probably damaging 1.00
IGL02829:Tenm4 APN 7 96894998 nonsense probably null
IGL02863:Tenm4 APN 7 96873706 missense probably damaging 1.00
IGL03145:Tenm4 APN 7 96842968 missense probably damaging 0.98
IGL03153:Tenm4 APN 7 96873762 missense probably damaging 1.00
principium UTSW 7 96797481 missense probably damaging 0.98
toccata UTSW 7 96902989 critical splice donor site probably null
P0026:Tenm4 UTSW 7 96874527 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0140:Tenm4 UTSW 7 96896052 missense possibly damaging 0.78
R0164:Tenm4 UTSW 7 96729340 splice site probably benign
R0277:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0323:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0362:Tenm4 UTSW 7 96772035 nonsense probably null
R0381:Tenm4 UTSW 7 96905881 missense probably damaging 1.00
R0420:Tenm4 UTSW 7 96873766 missense possibly damaging 0.85
R0426:Tenm4 UTSW 7 96777851 missense probably damaging 1.00
R0513:Tenm4 UTSW 7 96895623 missense probably benign 0.35
R0624:Tenm4 UTSW 7 96774020 missense probably damaging 1.00
R0837:Tenm4 UTSW 7 96896275 splice site probably benign
R1037:Tenm4 UTSW 7 96797481 missense probably damaging 0.98
R1172:Tenm4 UTSW 7 96848044 missense probably damaging 1.00
R1422:Tenm4 UTSW 7 96550051 missense probably damaging 0.99
R1427:Tenm4 UTSW 7 96843048 missense probably benign 0.42
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1597:Tenm4 UTSW 7 96902989 critical splice donor site probably null
R1701:Tenm4 UTSW 7 96902889 missense probably damaging 1.00
R1707:Tenm4 UTSW 7 96888685 missense probably damaging 1.00
R1809:Tenm4 UTSW 7 96873780 missense probably benign 0.17
R1812:Tenm4 UTSW 7 96895940 missense probably damaging 1.00
R1895:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R1933:Tenm4 UTSW 7 96895326 missense probably damaging 1.00
R1946:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R2108:Tenm4 UTSW 7 96906290 missense probably damaging 1.00
R2151:Tenm4 UTSW 7 96902847 missense probably damaging 1.00
R2247:Tenm4 UTSW 7 96906009 missense probably benign 0.03
R2329:Tenm4 UTSW 7 96895862 missense probably benign 0.00
R2893:Tenm4 UTSW 7 96894990 missense probably damaging 1.00
R2990:Tenm4 UTSW 7 96893125 synonymous probably null
R3409:Tenm4 UTSW 7 96895160 missense probably damaging 1.00
R3410:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3411:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3440:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3441:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3719:Tenm4 UTSW 7 96863563 missense possibly damaging 0.92
R3772:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R3773:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R4093:Tenm4 UTSW 7 96895772 missense probably damaging 1.00
R4439:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4441:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4510:Tenm4 UTSW 7 96894863 missense probably benign
R4511:Tenm4 UTSW 7 96894863 missense probably benign
R4543:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4645:Tenm4 UTSW 7 96895742 missense probably damaging 1.00
R4701:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R4707:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4714:Tenm4 UTSW 7 96894924 missense probably damaging 1.00
R4742:Tenm4 UTSW 7 96797484 missense probably damaging 0.99
R4784:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4785:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4801:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4802:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4880:Tenm4 UTSW 7 96905818 splice site probably null
R5036:Tenm4 UTSW 7 96694790 missense probably damaging 1.00
R5036:Tenm4 UTSW 7 96852561 missense probably damaging 1.00
R5050:Tenm4 UTSW 7 96895788 missense probably damaging 1.00
R5106:Tenm4 UTSW 7 96843149 missense probably damaging 0.99
R5118:Tenm4 UTSW 7 96893086 missense probably damaging 1.00
R5272:Tenm4 UTSW 7 96874203 missense probably damaging 0.98
R5282:Tenm4 UTSW 7 96837331 missense possibly damaging 0.90
R5403:Tenm4 UTSW 7 96888827 missense probably damaging 1.00
R5404:Tenm4 UTSW 7 96894680 missense probably damaging 1.00
R5567:Tenm4 UTSW 7 96896209 nonsense probably null
R5590:Tenm4 UTSW 7 96797400 missense possibly damaging 0.73
R5590:Tenm4 UTSW 7 96797401 missense possibly damaging 0.93
R5597:Tenm4 UTSW 7 96553517 missense probably benign 0.00
R5782:Tenm4 UTSW 7 96893039 missense probably benign 0.00
R5861:Tenm4 UTSW 7 96843217 intron probably benign
R5890:Tenm4 UTSW 7 96902860 missense probably damaging 1.00
R5930:Tenm4 UTSW 7 96854719 missense probably damaging 1.00
R5940:Tenm4 UTSW 7 96845895 missense probably damaging 1.00
R6012:Tenm4 UTSW 7 96522433 intron probably benign
R6060:Tenm4 UTSW 7 96873711 missense probably damaging 1.00
R6104:Tenm4 UTSW 7 96837289 missense probably damaging 0.97
R6283:Tenm4 UTSW 7 96874494 missense probably benign 0.33
R6333:Tenm4 UTSW 7 96774124 missense probably damaging 1.00
R6522:Tenm4 UTSW 7 96843044 missense possibly damaging 0.88
R6616:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6746:Tenm4 UTSW 7 96892860 missense probably damaging 1.00
R6751:Tenm4 UTSW 7 96845712 missense possibly damaging 0.95
R6806:Tenm4 UTSW 7 96811959 missense possibly damaging 0.95
R6807:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6807:Tenm4 UTSW 7 96895271 missense probably damaging 1.00
R6809:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6810:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6811:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6853:Tenm4 UTSW 7 96837295 missense possibly damaging 0.94
R6886:Tenm4 UTSW 7 96797392 missense possibly damaging 0.85
R6920:Tenm4 UTSW 7 96895550 missense probably damaging 1.00
R6937:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6939:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7011:Tenm4 UTSW 7 96896135 nonsense probably null
R7033:Tenm4 UTSW 7 96895223 nonsense probably null
R7040:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7083:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R7238:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96735813 missense possibly damaging 0.47
R7337:Tenm4 UTSW 7 96874126 missense probably benign 0.44
R7400:Tenm4 UTSW 7 96694803 missense probably damaging 0.97
X0021:Tenm4 UTSW 7 96873909 nonsense probably null
X0026:Tenm4 UTSW 7 96868087 missense probably damaging 0.98
X0066:Tenm4 UTSW 7 96848030 missense probably damaging 1.00
X0066:Tenm4 UTSW 7 96894794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTTCCAGGGTCATTGTCAC -3'
(R):5'- GACAATGGGGCCTTTCTCAG -3'

Sequencing Primer
(F):5'- ACTGTTTGTGACTGCAATCCG -3'
(R):5'- ATGGGGCCTTTCTCAGCACAG -3'
Posted On2016-06-15