Incidental Mutation 'R0443:Golga1'
ID39256
Institutional Source Beutler Lab
Gene Symbol Golga1
Ensembl Gene ENSMUSG00000026754
Gene Namegolgi autoantigen, golgin subfamily a, 1
Synonyms0710001G09Rik, Golgi97, golgin-97, 2210418B03Rik
MMRRC Submission 038644-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R0443 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location39016155-39065541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39018441 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 749 (S749T)
Ref Sequence ENSEMBL: ENSMUSP00000139001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039165] [ENSMUST00000090993] [ENSMUST00000112850] [ENSMUST00000112862] [ENSMUST00000184996]
Predicted Effect probably damaging
Transcript: ENSMUST00000039165
AA Change: S749T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037735
Gene: ENSMUSG00000026754
AA Change: S749T

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090993
SMART Domains Protein: ENSMUSP00000088516
Gene: ENSMUSG00000026755

DomainStartEndE-ValueType
Pfam:P16-Arc 8 153 4.6e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112850
AA Change: S724T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108471
Gene: ENSMUSG00000026754
AA Change: S724T

DomainStartEndE-ValueType
coiled coil region 53 144 N/A INTRINSIC
coiled coil region 165 530 N/A INTRINSIC
coiled coil region 574 622 N/A INTRINSIC
Grip 657 703 5.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112862
SMART Domains Protein: ENSMUSP00000108483
Gene: ENSMUSG00000026755

DomainStartEndE-ValueType
Pfam:P16-Arc 9 153 2.4e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149842
Predicted Effect probably benign
Transcript: ENSMUST00000153914
Predicted Effect unknown
Transcript: ENSMUST00000154210
AA Change: S72T
Predicted Effect probably damaging
Transcript: ENSMUST00000184996
AA Change: S749T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139001
Gene: ENSMUSG00000026754
AA Change: S749T

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204825
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein is associated with Sjogren's syndrome. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice exhibit tremors and limb grasping behavior at two months of age. A variable severity of hearing loss was also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3b G T 5: 25,848,411 R246L probably damaging Het
Adam18 T C 8: 24,629,637 probably null Het
Ankhd1 A G 18: 36,644,599 S1612G possibly damaging Het
Caskin1 C T 17: 24,505,400 A1054V probably damaging Het
Casz1 T C 4: 148,948,911 V1380A possibly damaging Het
Cnot6l T G 5: 96,091,745 probably benign Het
Crat T C 2: 30,403,628 probably benign Het
Ctgf T C 10: 24,595,803 probably benign Het
Cux2 C T 5: 121,887,437 R56H possibly damaging Het
Dst A G 1: 34,294,550 probably null Het
Dync2h1 G T 9: 7,167,244 probably null Het
Epg5 T C 18: 77,955,903 probably benign Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam20b A T 1: 156,681,453 D396E probably benign Het
Gapvd1 A G 2: 34,704,621 probably benign Het
Gsdma2 C T 11: 98,657,688 T255I probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Itgam C T 7: 128,081,634 A245V probably damaging Het
Kcnk15 A G 2: 163,858,323 T161A probably benign Het
Map3k19 A T 1: 127,822,415 N1066K probably benign Het
Ms4a6b A G 19: 11,521,680 I53V possibly damaging Het
Mtf1 C T 4: 124,824,282 probably benign Het
Neb T C 2: 52,161,477 probably null Het
Nop9 A G 14: 55,753,748 S621G probably benign Het
Olfr378 A G 11: 73,425,755 V76A probably damaging Het
Olfr459 T A 6: 41,771,895 I135F possibly damaging Het
Olfr484 A G 7: 108,124,816 V149A probably benign Het
Pacs1 A T 19: 5,272,583 Y102* probably null Het
Pcdhb10 A C 18: 37,412,432 D187A probably damaging Het
Pih1d2 A G 9: 50,621,103 R170G possibly damaging Het
Pikfyve A G 1: 65,196,706 H179R probably damaging Het
Pknox1 A G 17: 31,592,219 S156G probably damaging Het
Prkcz T A 4: 155,269,140 D250V probably damaging Het
Psg16 T A 7: 17,095,163 I224N probably benign Het
Slc25a40 T A 5: 8,447,348 S229T probably benign Het
Slc43a2 T C 11: 75,544,667 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tas2r129 G T 6: 132,951,196 C32F probably benign Het
Tfap2d C T 1: 19,104,367 R15C possibly damaging Het
Tonsl T C 15: 76,639,684 S39G probably benign Het
Trove2 A G 1: 143,765,923 probably benign Het
Trpc2 A G 7: 102,093,520 probably benign Het
Ttc17 A G 2: 94,378,094 F144S probably benign Het
Twnk G T 19: 45,008,139 G337V possibly damaging Het
Uvssa A G 5: 33,388,824 R180G possibly damaging Het
Vmn1r197 T A 13: 22,328,071 I54K possibly damaging Het
Vmn1r71 G A 7: 10,748,311 T84I probably benign Het
Zbtb49 T C 5: 38,200,830 E693G probably benign Het
Other mutations in Golga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Golga1 APN 2 39052973 nonsense probably null
IGL00949:Golga1 APN 2 39041255 missense probably damaging 0.98
IGL01133:Golga1 APN 2 39023472 missense probably benign
IGL01592:Golga1 APN 2 39063282 missense probably damaging 1.00
IGL01613:Golga1 APN 2 39020126 missense probably benign 0.14
IGL01819:Golga1 APN 2 39034149 missense probably benign 0.00
IGL01871:Golga1 APN 2 39050198 splice site probably benign
IGL02744:Golga1 APN 2 39018474 missense probably damaging 1.00
IGL02819:Golga1 APN 2 39039078 missense probably null 0.97
IGL02874:Golga1 APN 2 39039092 missense probably damaging 1.00
R0167:Golga1 UTSW 2 39047648 missense probably benign 0.00
R0245:Golga1 UTSW 2 39035259 missense probably benign 0.00
R0389:Golga1 UTSW 2 39018441 missense probably damaging 1.00
R0906:Golga1 UTSW 2 39047643 missense probably damaging 0.99
R1508:Golga1 UTSW 2 39023249 missense probably benign
R1901:Golga1 UTSW 2 39047780 splice site probably null
R1964:Golga1 UTSW 2 39047087 missense probably benign 0.00
R2228:Golga1 UTSW 2 39023171 missense probably benign 0.02
R3734:Golga1 UTSW 2 39050170 missense possibly damaging 0.88
R4407:Golga1 UTSW 2 39019641 unclassified probably null
R4504:Golga1 UTSW 2 39023454 missense probably benign 0.00
R4973:Golga1 UTSW 2 39039106 missense probably damaging 0.99
R5049:Golga1 UTSW 2 39047735 missense probably damaging 1.00
R5600:Golga1 UTSW 2 39020099 missense probably damaging 1.00
R6008:Golga1 UTSW 2 39047087 missense probably benign 0.00
R6374:Golga1 UTSW 2 39034068 missense probably benign
R6388:Golga1 UTSW 2 39023171 missense probably benign 0.02
R6601:Golga1 UTSW 2 39020106 missense probably damaging 1.00
R7067:Golga1 UTSW 2 39047719 missense probably benign 0.00
X0025:Golga1 UTSW 2 39052062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAGCACTGTGGAAATCTGGGC -3'
(R):5'- CCCCATGAAATTGCTAAGGCACCTG -3'

Sequencing Primer
(F):5'- AGTTCATTATCAGTCTACAGGGAGG -3'
(R):5'- GGGAGGAACCTCTTACAGTTCAC -3'
Posted On2013-05-23