Incidental Mutation 'R5104:Ptprb'
ID392569
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission 042692-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5104 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 116322459 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 765 (H765Q)
Ref Sequence ENSEMBL: ENSMUSP00000151821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect probably benign
Transcript: ENSMUST00000092167
AA Change: H478Q

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: H478Q

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217925
Predicted Effect probably benign
Transcript: ENSMUST00000218553
AA Change: H765Q

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,731,240 V883A probably benign Het
3632451O06Rik A T 14: 49,773,472 D259E possibly damaging Het
Adarb1 A G 10: 77,322,287 F109L probably damaging Het
Ano4 T A 10: 89,068,112 Q241L possibly damaging Het
Apof C T 10: 128,269,618 R214* probably null Het
Atl2 A T 17: 79,852,617 S47T probably benign Het
Azgp1 T G 5: 137,987,553 I146S probably damaging Het
Bicral G A 17: 46,801,256 T1006I probably damaging Het
Ccdc110 A T 8: 45,942,692 N540I probably damaging Het
Ccdc77 T C 6: 120,348,385 probably null Het
Cxcr5 G T 9: 44,513,319 P347Q probably benign Het
Cyp4a14 T G 4: 115,495,929 H62P probably damaging Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Ehd3 A G 17: 73,827,447 N267S probably benign Het
Eno4 A G 19: 58,945,541 Y58C probably benign Het
Fat2 A G 11: 55,278,988 Y2982H possibly damaging Het
Frmd3 C A 4: 74,145,078 A214D probably damaging Het
Gabrg1 A C 5: 70,774,432 S323A probably damaging Het
Gbp9 T C 5: 105,080,141 I592V probably benign Het
Gje1 G A 10: 14,716,718 Q107* probably null Het
Gm29609 T C 5: 31,154,294 probably null Het
Gpam A T 19: 55,093,986 F78I probably benign Het
Hecw1 T C 13: 14,340,792 R252G probably damaging Het
Hsd3b5 T A 3: 98,619,276 S285C probably damaging Het
Ighv1-74 T C 12: 115,802,887 K37E possibly damaging Het
Igkv8-34 T C 6: 70,044,154 D108G probably damaging Het
Il6st C G 13: 112,488,648 T266S probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kit A G 5: 75,615,478 T307A probably benign Het
Kmt2b G A 7: 30,569,840 R2552C probably damaging Het
Krt4 T A 15: 101,920,323 R369W probably damaging Het
Larp4 T A 15: 99,986,083 M8K probably damaging Het
Lrit3 T A 3: 129,788,391 H528L possibly damaging Het
Mia3 A G 1: 183,338,132 L157S probably damaging Het
Naa16 A T 14: 79,384,700 Y32* probably null Het
Nbea A G 3: 56,079,927 Y381H probably damaging Het
Nelfcd T C 2: 174,426,366 V475A probably benign Het
Noxa1 T C 2: 25,086,234 I347M probably benign Het
Olfr131 A T 17: 38,082,283 S232T possibly damaging Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr699 A T 7: 106,790,332 F223Y possibly damaging Het
Olfr747 T A 14: 50,680,702 K311* probably null Het
Pabpc1l T A 2: 164,043,587 I420K probably benign Het
Pi4ka C T 16: 17,281,050 C1990Y probably damaging Het
Pkhd1 T A 1: 20,585,191 Q223L probably damaging Het
Pkm G T 9: 59,668,681 probably null Het
Proz A G 8: 13,066,931 D161G probably damaging Het
Rffl A T 11: 82,812,793 C101* probably null Het
Rfx5 C T 3: 94,955,140 T36I probably benign Het
Rnase12 C A 14: 51,056,904 C106F probably damaging Het
Samd3 T C 10: 26,263,788 S273P possibly damaging Het
Simc1 A G 13: 54,526,362 D841G probably benign Het
Slc8a3 T C 12: 81,214,134 E607G probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Snx25 T C 8: 46,068,166 *143W probably null Het
Taf15 A G 11: 83,487,396 Y154C probably damaging Het
Tgfb3 A G 12: 86,058,982 V333A possibly damaging Het
Tiam1 A G 16: 89,818,041 S2P probably benign Het
Tmed11 T C 5: 108,777,276 probably null Het
Tmtc4 T C 14: 122,932,845 D585G probably damaging Het
Trabd2b T C 4: 114,406,917 S34P probably benign Het
Trbv13-2 T C 6: 41,121,811 Y107H probably damaging Het
Tuba3a A G 6: 125,282,384 V115A probably benign Het
Tut1 A G 19: 8,959,334 E174G probably benign Het
Ubr3 T A 2: 69,938,256 M469K probably damaging Het
Vcan C T 13: 89,657,472 probably benign Het
Wapl C T 14: 34,692,059 Q293* probably null Het
Wdr24 A G 17: 25,824,591 H129R probably damaging Het
Wrn A T 8: 33,267,867 probably null Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
R7495:Ptprb UTSW 10 116341448 missense probably benign 0.12
R7508:Ptprb UTSW 10 116353991 nonsense probably null
R7571:Ptprb UTSW 10 116339430 missense probably damaging 1.00
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AAGATCACATCTAACTCCTGTAGAGC -3'
(R):5'- GCGAATGCCATTACCTGTTC -3'

Sequencing Primer
(F):5'- TCCTGTAGAGCCCTGAACAGATG -3'
(R):5'- ACTCATGCTAGTGACAGTAGCCTTG -3'
Posted On2016-06-15