Incidental Mutation 'R5106:Slit3'
ID392642
Institutional Source Beutler Lab
Gene Symbol Slit3
Ensembl Gene ENSMUSG00000056427
Gene Nameslit guidance ligand 3
SynonymsSlit1
MMRRC Submission 042694-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R5106 (G1)
Quality Score134
Status Validated
Chromosome11
Chromosomal Location35121224-35708507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35612367 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 464 (C464R)
Ref Sequence ENSEMBL: ENSMUSP00000066857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069837]
Predicted Effect probably damaging
Transcript: ENSMUST00000069837
AA Change: C464R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066857
Gene: ENSMUSG00000056427
AA Change: C464R

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
LRRNT 33 65 2.12e-8 SMART
LRR 59 83 1.37e2 SMART
LRR_TYP 84 107 1.12e-3 SMART
LRR_TYP 108 131 7.78e-3 SMART
LRR_TYP 132 155 5.42e-2 SMART
LRR 156 179 5.88e0 SMART
LRR 180 203 7.55e-1 SMART
LRRCT 215 264 1.33e-6 SMART
LRRNT 279 311 6.79e-7 SMART
LRR 305 329 1.16e2 SMART
LRR 330 353 1.26e1 SMART
LRR_TYP 354 377 2.79e-4 SMART
LRR 378 401 4.05e-1 SMART
LRR 402 425 4.05e-1 SMART
LRRCT 437 486 7.75e-8 SMART
LRRNT 504 536 1.95e-7 SMART
LRR_TYP 556 579 7.49e-5 SMART
LRR 581 603 6.41e1 SMART
LRR_TYP 604 627 2.53e-2 SMART
LRR 628 651 1.76e-1 SMART
LRRCT 663 712 2.52e-7 SMART
LRRNT 724 756 3e-8 SMART
LRR 774 797 2.14e0 SMART
LRR_TYP 798 821 2.95e-3 SMART
LRR_TYP 822 845 2.43e-4 SMART
LRRCT 857 906 1.12e-13 SMART
EGF 919 953 6.86e-4 SMART
EGF 958 994 8.84e-7 SMART
EGF 999 1032 1.13e-4 SMART
EGF 1037 1072 2.3e-5 SMART
EGF_CA 1074 1110 5.92e-8 SMART
EGF 1122 1155 3.79e-6 SMART
LamG 1178 1314 3.16e-34 SMART
EGF 1331 1365 2.19e-2 SMART
EGF 1371 1403 1.13e-4 SMART
EGF 1411 1444 5.57e-4 SMART
CT 1455 1523 4.56e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124438
Meta Mutation Damage Score 0.392 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is secreted, likely interacting with roundabout homolog receptors to effect cell migration. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele show congenital diaphragmatic hernia (CDH), variable renal defects and enlarged heart right ventricles. Mice homozygous for either of two reporter alleles show diaphragm dysgenesis and die prematurely; those with end-stage CDH show dyspnea and lung congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C1qtnf2 G A 11: 43,486,053 R84Q possibly damaging Het
Carmil2 T A 8: 105,694,006 probably null Het
Cenpf A T 1: 189,683,808 C107S probably benign Het
Cideb T C 14: 55,754,525 M191V probably benign Het
Cope C A 8: 70,310,447 R213S possibly damaging Het
Ctcf T C 8: 105,681,498 probably benign Het
Daam2 T C 17: 49,476,461 Y647C probably damaging Het
Dlg2 T C 7: 92,442,686 Y920H probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fdps C A 3: 89,099,403 R127L probably damaging Het
G6pd2 C T 5: 61,810,352 T490I probably benign Het
Gm6401 A G 14: 41,965,506 M121T probably damaging Het
Gnl2 T C 4: 125,053,536 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l A G 17: 88,694,645 S310G possibly damaging Het
H2afy A G 13: 56,088,293 V213A possibly damaging Het
Igdcc4 T C 9: 65,124,701 F500L probably damaging Het
Lgr4 A T 2: 109,997,595 H207L probably damaging Het
Llcfc1 A G 6: 41,685,376 M105V probably benign Het
Map2k3 A G 11: 60,941,882 K18E probably damaging Het
Mccc1 T A 3: 35,972,564 D528V probably benign Het
Nedd4l C T 18: 65,193,305 T568M probably damaging Het
Nr3c1 A C 18: 39,486,601 I211S possibly damaging Het
Nudt5 C T 2: 5,854,829 probably benign Het
Olfr1176 T C 2: 88,340,110 Y182H probably benign Het
Olfr704 T A 7: 106,865,388 M136K probably damaging Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr826 A T 10: 130,180,308 S191T probably benign Het
Pcid2 A T 8: 13,079,648 F326I probably damaging Het
Pcnt A T 10: 76,401,444 I1336N probably damaging Het
Pomk T C 8: 25,986,376 D50G probably benign Het
Ppp2r2a T C 14: 67,023,097 Y244C probably damaging Het
Ptprz1 A G 6: 23,000,028 T706A probably benign Het
Rad54l G A 4: 116,099,764 probably benign Het
Raph1 T C 1: 60,533,300 D36G probably damaging Het
Rgs7 A G 1: 175,076,850 S166P possibly damaging Het
Rnf183 C G 4: 62,428,228 R111P probably damaging Het
Rp1l1 A T 14: 64,027,946 D327V probably damaging Het
Rpl3l A G 17: 24,732,437 Y156C probably damaging Het
Slc25a54 G T 3: 109,112,864 C398F probably benign Het
Slc39a2 A G 14: 51,895,531 *310W probably null Het
Smu1 A T 4: 40,743,104 F345I possibly damaging Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stxbp3 T C 3: 108,794,927 Y521C probably benign Het
Tenm4 T C 7: 96,843,149 S1061P probably damaging Het
Thoc5 T C 11: 4,910,630 S103P probably damaging Het
Tmem221 A G 8: 71,555,878 F173L probably benign Het
Trit1 T C 4: 123,054,313 probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r106 T C 17: 20,279,133 probably null Het
Vmn2r38 C A 7: 9,075,170 V738L possibly damaging Het
Zfp160 T A 17: 21,026,761 H524Q probably damaging Het
Zfp791 T A 8: 85,110,630 K202* probably null Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Zkscan7 T C 9: 122,896,133 probably benign Het
Zwilch A C 9: 64,153,584 F329V probably damaging Het
Other mutations in Slit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Slit3 APN 11 35622154 missense probably damaging 1.00
IGL01324:Slit3 APN 11 35610702 missense probably damaging 1.00
IGL01612:Slit3 APN 11 35700384 missense possibly damaging 0.95
IGL02145:Slit3 APN 11 35629742 missense probably damaging 0.99
IGL02146:Slit3 APN 11 35234848 missense possibly damaging 0.71
IGL02430:Slit3 APN 11 35177774 splice site probably null
IGL02528:Slit3 APN 11 35578974 missense probably benign
IGL02530:Slit3 APN 11 35708142 makesense probably null
IGL02640:Slit3 APN 11 35700345 missense probably benign 0.10
IGL02819:Slit3 APN 11 35171590 missense possibly damaging 0.71
IGL02839:Slit3 APN 11 35649047 missense possibly damaging 0.46
IGL03150:Slit3 APN 11 35508257 missense possibly damaging 0.88
IGL03161:Slit3 APN 11 35700414 missense probably benign 0.10
IGL03336:Slit3 APN 11 35670101 missense probably damaging 0.97
IGL02988:Slit3 UTSW 11 35708063 missense probably damaging 0.99
R0013:Slit3 UTSW 11 35707918 missense probably benign
R0013:Slit3 UTSW 11 35707918 missense probably benign
R0334:Slit3 UTSW 11 35579101 missense probably damaging 0.97
R0385:Slit3 UTSW 11 35700282 missense probably damaging 0.98
R0840:Slit3 UTSW 11 35623436 splice site probably benign
R1065:Slit3 UTSW 11 35121635 missense possibly damaging 0.86
R1364:Slit3 UTSW 11 35670107 missense probably benign
R1476:Slit3 UTSW 11 35686299 missense probably damaging 0.97
R1508:Slit3 UTSW 11 35570621 missense probably damaging 1.00
R1665:Slit3 UTSW 11 35234906 missense possibly damaging 0.71
R1692:Slit3 UTSW 11 35659344 missense probably damaging 1.00
R1696:Slit3 UTSW 11 35675923 missense probably damaging 0.99
R1727:Slit3 UTSW 11 35629832 missense probably damaging 1.00
R1752:Slit3 UTSW 11 35564653 missense probably damaging 0.98
R1970:Slit3 UTSW 11 35630841 critical splice acceptor site probably null
R2077:Slit3 UTSW 11 35544748 missense possibly damaging 0.88
R2126:Slit3 UTSW 11 35688679 missense probably damaging 1.00
R2143:Slit3 UTSW 11 35612261 splice site probably null
R2162:Slit3 UTSW 11 35688682 missense probably null 1.00
R2873:Slit3 UTSW 11 35544793 nonsense probably null
R3813:Slit3 UTSW 11 35675979 missense probably damaging 1.00
R3831:Slit3 UTSW 11 35688682 missense probably null 1.00
R3832:Slit3 UTSW 11 35688682 missense probably null 1.00
R3833:Slit3 UTSW 11 35688682 missense probably null 1.00
R3839:Slit3 UTSW 11 35508237 missense probably benign 0.10
R4152:Slit3 UTSW 11 35698320 missense probably damaging 0.98
R4387:Slit3 UTSW 11 35684048 missense probably benign 0.12
R4795:Slit3 UTSW 11 35651820 critical splice donor site probably null
R4910:Slit3 UTSW 11 35632722 missense probably damaging 0.99
R4933:Slit3 UTSW 11 35688593 missense probably damaging 1.00
R5048:Slit3 UTSW 11 35588985 missense probably damaging 1.00
R5138:Slit3 UTSW 11 35588985 missense probably damaging 1.00
R5218:Slit3 UTSW 11 35684175 critical splice donor site probably null
R5338:Slit3 UTSW 11 35622148 missense probably benign
R5354:Slit3 UTSW 11 35675913 missense probably damaging 1.00
R5436:Slit3 UTSW 11 35707911 missense probably benign 0.05
R5896:Slit3 UTSW 11 35708105 missense probably damaging 0.99
R5933:Slit3 UTSW 11 35629751 missense probably benign 0.04
R5963:Slit3 UTSW 11 35700236 missense probably damaging 1.00
R5964:Slit3 UTSW 11 35700236 missense probably damaging 1.00
R6125:Slit3 UTSW 11 35570733 critical splice donor site probably null
R6153:Slit3 UTSW 11 35700483 missense possibly damaging 0.69
R6484:Slit3 UTSW 11 35661298 missense probably benign
R6526:Slit3 UTSW 11 35661292 missense probably benign 0.33
R6797:Slit3 UTSW 11 35633952 missense possibly damaging 0.55
X0028:Slit3 UTSW 11 35564637 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTAGGGCCCAATACAAGAC -3'
(R):5'- CTGTAGGACTAACTGAATTTCCCC -3'

Sequencing Primer
(F):5'- CCCAATACAAGACAGGGTGGTG -3'
(R):5'- TTTGCAAAGAAGCTCCCAAGG -3'
Posted On2016-06-15