Incidental Mutation 'R5106:Rp1l1'
ID392650
Institutional Source Beutler Lab
Gene Symbol Rp1l1
Ensembl Gene ENSMUSG00000046049
Gene Nameretinitis pigmentosa 1 homolog like 1
SynonymsDcdc4, Rp1hl1
MMRRC Submission 042694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R5106 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location63992506-64035025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64027946 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 327 (D327V)
Ref Sequence ENSEMBL: ENSMUSP00000055449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058229]
Predicted Effect probably damaging
Transcript: ENSMUST00000058229
AA Change: D327V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: D327V

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
DCX 37 121 1.58e-13 SMART
DCX 155 239 1e-15 SMART
low complexity region 709 728 N/A INTRINSIC
low complexity region 870 884 N/A INTRINSIC
low complexity region 1159 1177 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1612 1618 N/A INTRINSIC
low complexity region 1642 1652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224314
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C1qtnf2 G A 11: 43,486,053 R84Q possibly damaging Het
Carmil2 T A 8: 105,694,006 probably null Het
Cenpf A T 1: 189,683,808 C107S probably benign Het
Cideb T C 14: 55,754,525 M191V probably benign Het
Cope C A 8: 70,310,447 R213S possibly damaging Het
Ctcf T C 8: 105,681,498 probably benign Het
Daam2 T C 17: 49,476,461 Y647C probably damaging Het
Dlg2 T C 7: 92,442,686 Y920H probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fdps C A 3: 89,099,403 R127L probably damaging Het
G6pd2 C T 5: 61,810,352 T490I probably benign Het
Gm6401 A G 14: 41,965,506 M121T probably damaging Het
Gnl2 T C 4: 125,053,536 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l A G 17: 88,694,645 S310G possibly damaging Het
H2afy A G 13: 56,088,293 V213A possibly damaging Het
Igdcc4 T C 9: 65,124,701 F500L probably damaging Het
Lgr4 A T 2: 109,997,595 H207L probably damaging Het
Llcfc1 A G 6: 41,685,376 M105V probably benign Het
Map2k3 A G 11: 60,941,882 K18E probably damaging Het
Mccc1 T A 3: 35,972,564 D528V probably benign Het
Nedd4l C T 18: 65,193,305 T568M probably damaging Het
Nr3c1 A C 18: 39,486,601 I211S possibly damaging Het
Nudt5 C T 2: 5,854,829 probably benign Het
Olfr1176 T C 2: 88,340,110 Y182H probably benign Het
Olfr704 T A 7: 106,865,388 M136K probably damaging Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr826 A T 10: 130,180,308 S191T probably benign Het
Pcid2 A T 8: 13,079,648 F326I probably damaging Het
Pcnt A T 10: 76,401,444 I1336N probably damaging Het
Pomk T C 8: 25,986,376 D50G probably benign Het
Ppp2r2a T C 14: 67,023,097 Y244C probably damaging Het
Ptprz1 A G 6: 23,000,028 T706A probably benign Het
Rad54l G A 4: 116,099,764 probably benign Het
Raph1 T C 1: 60,533,300 D36G probably damaging Het
Rgs7 A G 1: 175,076,850 S166P possibly damaging Het
Rnf183 C G 4: 62,428,228 R111P probably damaging Het
Rpl3l A G 17: 24,732,437 Y156C probably damaging Het
Slc25a54 G T 3: 109,112,864 C398F probably benign Het
Slc39a2 A G 14: 51,895,531 *310W probably null Het
Slit3 T C 11: 35,612,367 C464R probably damaging Het
Smu1 A T 4: 40,743,104 F345I possibly damaging Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stxbp3 T C 3: 108,794,927 Y521C probably benign Het
Tenm4 T C 7: 96,843,149 S1061P probably damaging Het
Thoc5 T C 11: 4,910,630 S103P probably damaging Het
Tmem221 A G 8: 71,555,878 F173L probably benign Het
Trit1 T C 4: 123,054,313 probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r106 T C 17: 20,279,133 probably null Het
Vmn2r38 C A 7: 9,075,170 V738L possibly damaging Het
Zfp160 T A 17: 21,026,761 H524Q probably damaging Het
Zfp791 T A 8: 85,110,630 K202* probably null Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Zkscan7 T C 9: 122,896,133 probably benign Het
Zwilch A C 9: 64,153,584 F329V probably damaging Het
Other mutations in Rp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Rp1l1 APN 14 64028725 missense probably benign 0.01
IGL02063:Rp1l1 APN 14 64029536 missense probably damaging 0.99
IGL02132:Rp1l1 APN 14 64028810 missense probably benign
IGL02430:Rp1l1 APN 14 64029286 missense probably benign 0.00
IGL02977:Rp1l1 APN 14 64028150 missense probably benign 0.01
IGL03213:Rp1l1 APN 14 64028415 missense probably damaging 0.98
IGL03346:Rp1l1 APN 14 64029440 missense probably benign
R0085:Rp1l1 UTSW 14 64022295 missense probably damaging 0.99
R0347:Rp1l1 UTSW 14 64030804 nonsense probably null
R0362:Rp1l1 UTSW 14 64031066 nonsense probably null
R0369:Rp1l1 UTSW 14 64029388 missense possibly damaging 0.84
R0538:Rp1l1 UTSW 14 64022092 missense probably damaging 1.00
R0544:Rp1l1 UTSW 14 64032066 missense probably benign 0.00
R0780:Rp1l1 UTSW 14 64030351 missense possibly damaging 0.94
R0944:Rp1l1 UTSW 14 64032232 missense probably benign 0.05
R1051:Rp1l1 UTSW 14 64032535 missense probably damaging 0.99
R1126:Rp1l1 UTSW 14 64030469 missense probably damaging 1.00
R1450:Rp1l1 UTSW 14 64028150 missense probably benign 0.01
R1483:Rp1l1 UTSW 14 64029047 missense possibly damaging 0.76
R1508:Rp1l1 UTSW 14 64030892 missense possibly damaging 0.83
R1553:Rp1l1 UTSW 14 64031894 missense probably benign 0.00
R1651:Rp1l1 UTSW 14 64030993 missense probably damaging 0.97
R1682:Rp1l1 UTSW 14 64028968 missense probably damaging 0.98
R1809:Rp1l1 UTSW 14 64027966 missense probably benign 0.18
R1885:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1887:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1898:Rp1l1 UTSW 14 64031590 missense probably benign 0.04
R1924:Rp1l1 UTSW 14 64031543 missense probably benign
R1939:Rp1l1 UTSW 14 64029593 missense probably benign
R1941:Rp1l1 UTSW 14 64022252 missense probably damaging 1.00
R2129:Rp1l1 UTSW 14 64028966 missense possibly damaging 0.93
R2363:Rp1l1 UTSW 14 64029998 missense possibly damaging 0.55
R3894:Rp1l1 UTSW 14 64029307 missense probably benign
R3974:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3975:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3976:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R4072:Rp1l1 UTSW 14 64028132 missense probably damaging 1.00
R4672:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4673:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4749:Rp1l1 UTSW 14 64029800 missense probably damaging 0.99
R4755:Rp1l1 UTSW 14 64030070 missense probably benign 0.34
R4877:Rp1l1 UTSW 14 64026171 missense probably benign 0.00
R4930:Rp1l1 UTSW 14 64032206 missense probably benign
R5039:Rp1l1 UTSW 14 64031356 missense probably benign 0.21
R5184:Rp1l1 UTSW 14 64030180 missense probably damaging 1.00
R5215:Rp1l1 UTSW 14 64030013 missense probably benign 0.01
R5409:Rp1l1 UTSW 14 64030621 missense probably benign 0.02
R5575:Rp1l1 UTSW 14 64030984 missense probably benign 0.23
R5696:Rp1l1 UTSW 14 64029746 missense probably damaging 0.99
R5739:Rp1l1 UTSW 14 64032170 missense probably benign 0.01
R5878:Rp1l1 UTSW 14 64028906 missense probably benign 0.09
R6133:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6134:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6135:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6428:Rp1l1 UTSW 14 64032389 missense possibly damaging 0.92
R6594:Rp1l1 UTSW 14 64031677 nonsense probably null
R6736:Rp1l1 UTSW 14 64029724 missense possibly damaging 0.93
R6800:Rp1l1 UTSW 14 64031150 missense possibly damaging 0.92
R6848:Rp1l1 UTSW 14 64028218 missense possibly damaging 0.79
R6878:Rp1l1 UTSW 14 64031852 missense probably benign 0.00
R6922:Rp1l1 UTSW 14 64030385 missense possibly damaging 0.93
R6980:Rp1l1 UTSW 14 64028720 missense probably benign 0.02
R7053:Rp1l1 UTSW 14 64031509 missense possibly damaging 0.68
R7151:Rp1l1 UTSW 14 64029026 missense not run
X0057:Rp1l1 UTSW 14 64030040 missense probably benign 0.14
X0063:Rp1l1 UTSW 14 64029223 missense probably damaging 0.98
Z1088:Rp1l1 UTSW 14 64028758 missense possibly damaging 0.80
Z1088:Rp1l1 UTSW 14 64030378 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTAGCTCACTGCCTTGTTC -3'
(R):5'- TGCAACAGAACCTGTCAGCC -3'

Sequencing Primer
(F):5'- GACAGGTTGCTGGGGAC -3'
(R):5'- AGAACCTGTCAGCCTCCCTC -3'
Posted On2016-06-15