Incidental Mutation 'R5117:Med21'
ID392679
Institutional Source Beutler Lab
Gene Symbol Med21
Ensembl Gene ENSMUSG00000030291
Gene Namemediator complex subunit 21
Synonyms0610007L03Rik, Srb7, D6Ertd782e, Surb7
MMRRC Submission 042705-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5117 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location146642547-146650732 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 146647283 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032429] [ENSMUST00000111650] [ENSMUST00000204040]
Predicted Effect probably benign
Transcript: ENSMUST00000032429
SMART Domains Protein: ENSMUSP00000032429
Gene: ENSMUSG00000030291

DomainStartEndE-ValueType
Pfam:Med21 1 127 1.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075077
Predicted Effect probably benign
Transcript: ENSMUST00000111650
SMART Domains Protein: ENSMUSP00000107277
Gene: ENSMUSG00000030291

DomainStartEndE-ValueType
Pfam:Med21 1 90 8.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203416
Predicted Effect probably benign
Transcript: ENSMUST00000204040
SMART Domains Protein: ENSMUSP00000145512
Gene: ENSMUSG00000030291

DomainStartEndE-ValueType
Pfam:Med21 1 127 1.1e-29 PFAM
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mediator complex subunit 21 family. The encoded protein interacts with the human RNA polymerase II holoenzyme and is involved in transcriptional regulation of RNA polymerase II transcribed genes. A pseudogene of this gene is located on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die at the blastocyst stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik G A 9: 124,293,085 T403I probably benign Het
4921509C19Rik T C 2: 151,472,540 E406G probably benign Het
Abca8b T C 11: 109,966,803 E641G probably damaging Het
Agrn T C 4: 156,185,553 N49S probably benign Het
BC005561 A G 5: 104,520,255 Y881C probably damaging Het
Cacna1b A G 2: 24,732,328 S215P probably damaging Het
Cacna1g T A 11: 94,432,503 I1292F probably damaging Het
Card14 T A 11: 119,338,250 I662N probably damaging Het
Cep135 A G 5: 76,631,429 K762R probably benign Het
Ces1b A G 8: 93,073,209 probably null Het
Erich6 T G 3: 58,623,205 I448L probably benign Het
Fads3 T G 19: 10,041,958 probably null Het
Fam234a A G 17: 26,213,538 F546L probably benign Het
Gm10717 T C 9: 3,025,625 L70S probably benign Het
Gm11787 G T 4: 3,509,524 noncoding transcript Het
Gm5519 A G 19: 33,825,071 *171W probably null Het
Grasp A G 15: 101,230,537 D152G probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Hmcn2 T G 2: 31,458,049 C4902W possibly damaging Het
Hsp90aa1 T C 12: 110,695,264 N106S possibly damaging Het
Il18 A T 9: 50,581,509 N125I possibly damaging Het
Ints9 G T 14: 64,993,091 E156* probably null Het
Kalrn T C 16: 34,033,601 probably null Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Lipo3 A T 19: 33,559,552 M256K probably benign Het
Lrrc29 T A 8: 105,312,860 R595* probably null Het
Mapk6 C A 9: 75,397,735 M133I possibly damaging Het
Myrf T A 19: 10,212,493 E984V probably damaging Het
Naga A C 15: 82,337,456 M28R probably damaging Het
Nphp4 T G 4: 152,524,232 probably null Het
Nr1h4 T C 10: 89,478,422 N295D probably damaging Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Olfr543 T C 7: 102,477,502 M123V probably damaging Het
Olfr702 A T 7: 106,823,662 I288N probably damaging Het
Parp9 C A 16: 35,971,832 probably null Het
Pax4 T C 6: 28,446,279 I72V probably benign Het
Pcdh7 A G 5: 57,721,748 I542V probably benign Het
Pcdhgb7 C T 18: 37,752,886 R370W probably damaging Het
Pik3r1 G A 13: 101,692,236 T18I probably benign Het
Ppara A G 15: 85,777,761 I68V probably benign Het
Ptch2 T A 4: 117,105,949 I211N probably damaging Het
Senp6 G A 9: 80,130,746 V715M probably damaging Het
Serf2 C T 2: 121,450,703 P41L possibly damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Serpinf2 T C 11: 75,432,500 D460G probably benign Het
Sh3d21 T C 4: 126,151,872 E338G probably damaging Het
Slc7a11 T C 3: 50,379,150 D384G probably damaging Het
Snx15 A G 19: 6,124,151 probably null Het
Supt16 A G 14: 52,183,092 F84L probably damaging Het
Tm9sf2 C A 14: 122,143,501 Q169K probably benign Het
Trim56 A T 5: 137,113,978 V228E probably benign Het
Triqk T A 4: 12,980,390 probably null Het
Ttc21a T A 9: 119,966,565 I1155N possibly damaging Het
Ube3b T G 5: 114,419,631 Y1059D probably damaging Het
Vmn2r14 T C 5: 109,216,095 T652A probably benign Het
Wdr4 A G 17: 31,499,824 V304A probably benign Het
Wwp2 T C 8: 107,554,062 S646P possibly damaging Het
Zfand5 T A 19: 21,279,645 S130T probably benign Het
Zfp599 A T 9: 22,250,100 Y256* probably null Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfyve16 T A 13: 92,505,689 I1209L possibly damaging Het
Other mutations in Med21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02647:Med21 APN 6 146649233 missense probably benign 0.44
IGL03369:Med21 APN 6 146642645 missense probably benign 0.21
R0049:Med21 UTSW 6 146650234 missense probably damaging 0.99
R0049:Med21 UTSW 6 146650234 missense probably damaging 0.99
R0967:Med21 UTSW 6 146650199 missense probably benign 0.02
R2106:Med21 UTSW 6 146649212 missense probably damaging 1.00
R4403:Med21 UTSW 6 146649182 nonsense probably null
R4675:Med21 UTSW 6 146650193 missense probably damaging 0.97
R4747:Med21 UTSW 6 146649202 missense possibly damaging 0.58
R4749:Med21 UTSW 6 146650101 splice site probably null
R4855:Med21 UTSW 6 146648192 missense probably damaging 1.00
R5344:Med21 UTSW 6 146649185 missense probably benign 0.39
R7338:Med21 UTSW 6 146642584 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGAGTTATGATTTGCAGGAGTCT -3'
(R):5'- TTCGGAACATTGTAGAAGCCG -3'

Sequencing Primer
(F):5'- GCTACATGTAAGCGTATGTACCATG -3'
(R):5'- GCTGCTGTCAGGGACATATC -3'
Posted On2016-06-15