Incidental Mutation 'R5117:Fads3'
ID392715
Institutional Source Beutler Lab
Gene Symbol Fads3
Ensembl Gene ENSMUSG00000024664
Gene Namefatty acid desaturase 3
Synonyms
MMRRC Submission 042705-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5117 (G1)
Quality Score145
Status Validated
Chromosome19
Chromosomal Location10041548-10059671 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 10041958 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115995] [ENSMUST00000144788]
Predicted Effect probably null
Transcript: ENSMUST00000115995
SMART Domains Protein: ENSMUSP00000111659
Gene: ENSMUSG00000024664

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Cyt-b5 27 101 6.21e-16 SMART
Pfam:FA_desaturase 162 423 4.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144788
SMART Domains Protein: ENSMUSP00000121449
Gene: ENSMUSG00000024663

DomainStartEndE-ValueType
Pfam:Sec2p 89 198 4.4e-30 PFAM
Meta Mutation Damage Score 0.588 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout affects highly unsaturated fatty acid levels in the liver and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik G A 9: 124,293,085 T403I probably benign Het
4921509C19Rik T C 2: 151,472,540 E406G probably benign Het
Abca8b T C 11: 109,966,803 E641G probably damaging Het
Agrn T C 4: 156,185,553 N49S probably benign Het
BC005561 A G 5: 104,520,255 Y881C probably damaging Het
Cacna1b A G 2: 24,732,328 S215P probably damaging Het
Cacna1g T A 11: 94,432,503 I1292F probably damaging Het
Card14 T A 11: 119,338,250 I662N probably damaging Het
Cep135 A G 5: 76,631,429 K762R probably benign Het
Ces1b A G 8: 93,073,209 probably null Het
Erich6 T G 3: 58,623,205 I448L probably benign Het
Fam234a A G 17: 26,213,538 F546L probably benign Het
Gm10717 T C 9: 3,025,625 L70S probably benign Het
Gm11787 G T 4: 3,509,524 noncoding transcript Het
Gm5519 A G 19: 33,825,071 *171W probably null Het
Grasp A G 15: 101,230,537 D152G probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Hmcn2 T G 2: 31,458,049 C4902W possibly damaging Het
Hsp90aa1 T C 12: 110,695,264 N106S possibly damaging Het
Il18 A T 9: 50,581,509 N125I possibly damaging Het
Ints9 G T 14: 64,993,091 E156* probably null Het
Kalrn T C 16: 34,033,601 probably null Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Lipo3 A T 19: 33,559,552 M256K probably benign Het
Lrrc29 T A 8: 105,312,860 R595* probably null Het
Mapk6 C A 9: 75,397,735 M133I possibly damaging Het
Med21 T A 6: 146,647,283 probably benign Het
Myrf T A 19: 10,212,493 E984V probably damaging Het
Naga A C 15: 82,337,456 M28R probably damaging Het
Nphp4 T G 4: 152,524,232 probably null Het
Nr1h4 T C 10: 89,478,422 N295D probably damaging Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Olfr543 T C 7: 102,477,502 M123V probably damaging Het
Olfr702 A T 7: 106,823,662 I288N probably damaging Het
Parp9 C A 16: 35,971,832 probably null Het
Pax4 T C 6: 28,446,279 I72V probably benign Het
Pcdh7 A G 5: 57,721,748 I542V probably benign Het
Pcdhgb7 C T 18: 37,752,886 R370W probably damaging Het
Pik3r1 G A 13: 101,692,236 T18I probably benign Het
Ppara A G 15: 85,777,761 I68V probably benign Het
Ptch2 T A 4: 117,105,949 I211N probably damaging Het
Senp6 G A 9: 80,130,746 V715M probably damaging Het
Serf2 C T 2: 121,450,703 P41L possibly damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Serpinf2 T C 11: 75,432,500 D460G probably benign Het
Sh3d21 T C 4: 126,151,872 E338G probably damaging Het
Slc7a11 T C 3: 50,379,150 D384G probably damaging Het
Snx15 A G 19: 6,124,151 probably null Het
Supt16 A G 14: 52,183,092 F84L probably damaging Het
Tm9sf2 C A 14: 122,143,501 Q169K probably benign Het
Trim56 A T 5: 137,113,978 V228E probably benign Het
Triqk T A 4: 12,980,390 probably null Het
Ttc21a T A 9: 119,966,565 I1155N possibly damaging Het
Ube3b T G 5: 114,419,631 Y1059D probably damaging Het
Vmn2r14 T C 5: 109,216,095 T652A probably benign Het
Wdr4 A G 17: 31,499,824 V304A probably benign Het
Wwp2 T C 8: 107,554,062 S646P possibly damaging Het
Zfand5 T A 19: 21,279,645 S130T probably benign Het
Zfp599 A T 9: 22,250,100 Y256* probably null Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfyve16 T A 13: 92,505,689 I1209L possibly damaging Het
Other mutations in Fads3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fads3 APN 19 10052299 missense probably null 0.98
IGL00422:Fads3 APN 19 10055681 missense possibly damaging 0.80
IGL01081:Fads3 APN 19 10053002 missense probably benign 0.00
IGL02454:Fads3 APN 19 10055119 missense probably damaging 0.97
IGL02477:Fads3 APN 19 10056442 missense probably damaging 1.00
R0611:Fads3 UTSW 19 10041836 missense probably damaging 1.00
R1169:Fads3 UTSW 19 10054099 missense possibly damaging 0.82
R1400:Fads3 UTSW 19 10056300 splice site probably null
R1893:Fads3 UTSW 19 10056504 missense probably benign
R2508:Fads3 UTSW 19 10056454 missense probably damaging 1.00
R3151:Fads3 UTSW 19 10057898 missense probably benign 0.01
R4543:Fads3 UTSW 19 10041811 missense possibly damaging 0.60
R4766:Fads3 UTSW 19 10056020 missense possibly damaging 0.94
R4823:Fads3 UTSW 19 10041888 missense probably damaging 0.98
R5846:Fads3 UTSW 19 10053033 missense probably null 1.00
R6117:Fads3 UTSW 19 10054267 missense probably damaging 1.00
R6225:Fads3 UTSW 19 10041838 missense probably benign 0.25
X0027:Fads3 UTSW 19 10054250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGTACAGCGGCAATGGG -3'
(R):5'- GAAAGAGACCTCCTTCCCTCAG -3'

Sequencing Primer
(F):5'- CAATGGGCGGTGTCGGG -3'
(R):5'- AGGCTCCATCTCAACTCTGG -3'
Posted On2016-06-15