Incidental Mutation 'R5118:Galnt5'
ID392721
Institutional Source Beutler Lab
Gene Symbol Galnt5
Ensembl Gene ENSMUSG00000026828
Gene Namepolypeptide N-acetylgalactosaminyltransferase 5
SynonymsppGaNTase-T5
MMRRC Submission 042706-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5118 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location57997884-58045860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58015003 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 526 (D526G)
Ref Sequence ENSEMBL: ENSMUSP00000131362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112616] [ENSMUST00000166729]
Predicted Effect probably damaging
Transcript: ENSMUST00000112616
AA Change: D526G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108235
Gene: ENSMUSG00000026828
AA Change: D526G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 1.3e-33 PFAM
Pfam:Glyco_transf_7C 653 718 1.9e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144671
Predicted Effect probably damaging
Transcript: ENSMUST00000166729
AA Change: D526G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131362
Gene: ENSMUSG00000026828
AA Change: D526G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 2.1e-30 PFAM
Pfam:Glyco_transf_7C 652 718 7e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Meta Mutation Damage Score 0.554 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound polypeptide N-acetylgalactosaminyltransferase that is found in the Golgi. The encoded protein catalyzes the first step in the mucin-type O-glycosylation of Golgi proteins, transfering an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. [provided by RefSeq, Aug 2016]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S187G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Gm1330 T C 2: 149,002,986 probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in Galnt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Galnt5 APN 2 57998973 missense probably benign
IGL00515:Galnt5 APN 2 57999068 missense probably benign 0.02
IGL00950:Galnt5 APN 2 57999132 missense probably benign 0.00
IGL00973:Galnt5 APN 2 57998939 missense probably benign 0.02
IGL01152:Galnt5 APN 2 58025393 missense probably benign 0.17
IGL01305:Galnt5 APN 2 58025342 nonsense probably null
IGL01661:Galnt5 APN 2 57999482 missense probably benign 0.03
IGL01719:Galnt5 APN 2 57998543 missense probably damaging 1.00
IGL02165:Galnt5 APN 2 57998865 missense probably benign
IGL02795:Galnt5 APN 2 58027871 missense probably damaging 1.00
IGL02943:Galnt5 APN 2 57999768 missense probably damaging 1.00
IGL03218:Galnt5 APN 2 57999389 missense possibly damaging 0.59
ANU22:Galnt5 UTSW 2 58025342 nonsense probably null
R0082:Galnt5 UTSW 2 57999035 missense possibly damaging 0.92
R0113:Galnt5 UTSW 2 57998877 missense probably benign
R0445:Galnt5 UTSW 2 57998950 missense probably benign
R0517:Galnt5 UTSW 2 58035373 splice site probably benign
R0609:Galnt5 UTSW 2 58024625 missense possibly damaging 0.90
R0639:Galnt5 UTSW 2 57999395 missense probably benign 0.07
R0646:Galnt5 UTSW 2 57999085 missense probably benign 0.00
R0677:Galnt5 UTSW 2 57998980 nonsense probably null
R1808:Galnt5 UTSW 2 58026125 missense probably benign 0.24
R1927:Galnt5 UTSW 2 57998603 missense probably benign 0.00
R1980:Galnt5 UTSW 2 58024723 critical splice donor site probably null
R2517:Galnt5 UTSW 2 57999413 missense probably benign 0.00
R4044:Galnt5 UTSW 2 57998460 missense probably damaging 1.00
R4154:Galnt5 UTSW 2 57998493 missense probably damaging 1.00
R4411:Galnt5 UTSW 2 57999195 missense probably benign 0.01
R4703:Galnt5 UTSW 2 57998907 missense possibly damaging 0.96
R4767:Galnt5 UTSW 2 58028144 missense possibly damaging 0.91
R5497:Galnt5 UTSW 2 58025328 missense probably damaging 0.99
R5506:Galnt5 UTSW 2 57999625 missense probably benign
R5548:Galnt5 UTSW 2 58014910 missense probably damaging 0.99
R5758:Galnt5 UTSW 2 57998430 missense probably benign 0.19
R5937:Galnt5 UTSW 2 58038937 missense probably benign 0.00
R6237:Galnt5 UTSW 2 58035249 missense probably damaging 0.96
R6805:Galnt5 UTSW 2 58035299 missense possibly damaging 0.82
R6959:Galnt5 UTSW 2 57999219 missense probably benign 0.39
R7070:Galnt5 UTSW 2 57998609 missense probably benign 0.00
R7179:Galnt5 UTSW 2 57998609 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTGTGCTTATATCCTGGCCCAG -3'
(R):5'- GGCAATGCCTGAAACATACAG -3'

Sequencing Primer
(F):5'- CAGGTGTGCAGAGCAACTAGTTC -3'
(R):5'- TGTACTACACGCATGCAGTG -3'
Posted On2016-06-15