Incidental Mutation 'R5118:Msh3'
ID392761
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene NamemutS homolog 3
SynonymsRep3, Rep-3, D13Em1
MMRRC Submission 042706-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R5118 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92211872-92355003 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 92309434 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187874] [ENSMUST00000191509] [ENSMUST00000191550]
Predicted Effect probably benign
Transcript: ENSMUST00000022220
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185852
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187874
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190462
Predicted Effect probably benign
Transcript: ENSMUST00000191509
SMART Domains Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191550
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S215G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm1330 T C 2: 149,002,986 D89G probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 F225S probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Mul1 T A 4: 138,439,349 L243Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92344964 missense probably damaging 1.00
IGL00983:Msh3 APN 13 92300277 missense probably damaging 1.00
IGL01490:Msh3 APN 13 92300305 missense probably damaging 1.00
IGL02072:Msh3 APN 13 92300295 missense probably damaging 1.00
IGL02313:Msh3 APN 13 92349312 missense possibly damaging 0.87
IGL02711:Msh3 APN 13 92351311 missense probably damaging 1.00
IGL03108:Msh3 APN 13 92221088 unclassified probably benign
IGL03227:Msh3 APN 13 92285960 missense probably damaging 0.98
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0415:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92220997 missense probably damaging 1.00
R0659:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0661:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92347340 nonsense probably null
R1605:Msh3 UTSW 13 92300275 missense probably null 1.00
R1622:Msh3 UTSW 13 92344954 critical splice donor site probably null
R1771:Msh3 UTSW 13 92212496 missense probably benign 0.05
R1970:Msh3 UTSW 13 92249820 splice site probably benign
R1971:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R1971:Msh3 UTSW 13 92249820 splice site probably benign
R2894:Msh3 UTSW 13 92342360 missense probably benign 0.16
R3837:Msh3 UTSW 13 92354858 missense probably damaging 1.00
R4119:Msh3 UTSW 13 92354011 intron probably benign
R4225:Msh3 UTSW 13 92285923 missense probably benign 0.03
R4881:Msh3 UTSW 13 92266041 intron probably benign
R5209:Msh3 UTSW 13 92344954 critical splice donor site probably null
R5817:Msh3 UTSW 13 92286000 missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92249878 missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92215522 missense probably benign 0.00
R5940:Msh3 UTSW 13 92249843 missense probably damaging 1.00
R6004:Msh3 UTSW 13 92342414 critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92212524 missense probably damaging 1.00
R6510:Msh3 UTSW 13 92353264 nonsense probably null
R6654:Msh3 UTSW 13 92345042 missense probably benign 0.01
R6853:Msh3 UTSW 13 92312572 critical splice donor site probably null
S24628:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
X0027:Msh3 UTSW 13 92274070 missense probably damaging 0.98
X0063:Msh3 UTSW 13 92274785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCGTTAGTGATAAGCCTCTGAG -3'
(R):5'- TCCAAATGCAAGCTTGGTATACATG -3'

Sequencing Primer
(F):5'- cccaaaggctcatgcatt -3'
(R):5'- AACTTGGAGAAGCCTGTG -3'
Posted OnJun 15, 2016