Incidental Mutation 'R5119:Kcnt1'
ID392778
Institutional Source Beutler Lab
Gene Symbol Kcnt1
Ensembl Gene ENSMUSG00000058740
Gene Namepotassium channel, subfamily T, member 1
SynonymsC030030G16Rik, Slack, slo2
MMRRC Submission 042707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R5119 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25863734-25918273 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 25909322 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037580] [ENSMUST00000114172] [ENSMUST00000114176] [ENSMUST00000153001] [ENSMUST00000171268] [ENSMUST00000197917] [ENSMUST00000198204] [ENSMUST00000200434]
Predicted Effect probably benign
Transcript: ENSMUST00000037580
SMART Domains Protein: ENSMUSP00000039058
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 252 335 1.3e-12 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 477 579 5.8e-32 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1212 1229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114172
SMART Domains Protein: ENSMUSP00000109809
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114176
SMART Domains Protein: ENSMUSP00000109813
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.1e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.2e-38 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145544
Predicted Effect probably benign
Transcript: ENSMUST00000153001
SMART Domains Protein: ENSMUSP00000142532
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
PDB:4HPF|B 79 285 6e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171268
SMART Domains Protein: ENSMUSP00000132212
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Ion_trans_2 235 315 5.1e-13 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Pfam:BK_channel_a 455 560 3.2e-38 PFAM
PDB:3U6N|H 774 963 7e-6 PDB
low complexity region 1039 1056 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197917
SMART Domains Protein: ENSMUSP00000143106
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198204
SMART Domains Protein: ENSMUSP00000142870
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.2e-35 PFAM
PDB:3U6N|H 760 949 6e-6 PDB
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199269
Predicted Effect probably benign
Transcript: ENSMUST00000200434
SMART Domains Protein: ENSMUSP00000143482
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5.1e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.3e-35 PFAM
PDB:3U6N|H 758 947 6e-6 PDB
low complexity region 1023 1040 N/A INTRINSIC
low complexity region 1176 1193 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (127/127)
MGI Phenotype FUNCTION: This gene encodes a member of the Slo potassium channel family that has shown to be activated by both sodium and chloride ions. This channel represents the largest potassium channel subunit yet identified. This channel may be important in development and pain signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired action potential firing in sensory neurons and increased mechanical hypersensitivity in neuropathic pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik C A 2: 170,579,585 G125V unknown Het
Actr6 A T 10: 89,725,855 L143Q probably damaging Het
Adamts18 A G 8: 113,699,010 Y1207H probably benign Het
Adamts5 T A 16: 85,899,578 R230S probably benign Het
Adat2 A T 10: 13,556,906 N51Y probably damaging Het
Adgrv1 T C 13: 81,419,427 Y5209C possibly damaging Het
Ahnak G T 19: 9,013,644 M4097I probably benign Het
Akap13 A G 7: 75,687,252 T820A probably damaging Het
Als2cl C T 9: 110,890,819 R492C probably damaging Het
Aox3 G A 1: 58,188,524 probably null Het
Arid4b G A 13: 14,164,281 V446M probably benign Het
Armc2 A G 10: 41,922,148 L794P probably damaging Het
Atp6v0a1 T A 11: 101,020,515 M80K probably benign Het
Aup1 T C 6: 83,055,134 V94A probably damaging Het
Bank1 A T 3: 136,234,682 I180K possibly damaging Het
Becn1 A G 11: 101,291,395 L116P probably damaging Het
Bsg A G 10: 79,710,223 probably benign Het
Camk2a A T 18: 60,943,136 probably benign Het
Ccdc180 A G 4: 45,914,603 E706G possibly damaging Het
Cdk8 A T 5: 146,283,627 probably null Het
Cpne4 A G 9: 104,901,521 probably null Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Cyp2c38 C A 19: 39,460,621 G96V probably damaging Het
Dhx40 A G 11: 86,776,636 I261T probably damaging Het
Dnah10 T C 5: 124,779,258 F2038L probably damaging Het
Dnah7a A T 1: 53,698,692 D27E probably benign Het
Dock10 A T 1: 80,567,994 probably null Het
Dst A T 1: 34,195,969 K3710* probably null Het
Dtl G T 1: 191,541,506 A430D probably damaging Het
Ece2 T C 16: 20,618,631 L241P probably damaging Het
Ecel1 T A 1: 87,151,139 Y526F probably benign Het
Enpp2 T A 15: 54,870,305 R420* probably null Het
Epb41 A C 4: 131,937,436 probably benign Het
Eppin T C 2: 164,589,451 Y85C probably damaging Het
Fam171a2 G A 11: 102,438,733 A400V probably damaging Het
Fam71b G A 11: 46,407,036 G389D probably damaging Het
Fem1c A C 18: 46,506,369 C189G probably damaging Het
Frmd4b A G 6: 97,300,314 V560A probably benign Het
Fsip2 A T 2: 82,988,191 D4756V probably damaging Het
Gabbr1 T C 17: 37,048,438 S102P probably damaging Het
Gm28042 G A 2: 120,034,643 A250T probably damaging Het
Gm42877 T C 14: 54,075,521 probably benign Het
Gm9762 A T 3: 78,966,400 noncoding transcript Het
Gpr183 G T 14: 121,954,863 T82N possibly damaging Het
Gps2 A G 11: 69,914,791 K45R probably benign Het
Gramd2 A G 9: 59,714,320 probably benign Het
Grap2 G A 15: 80,646,144 R155Q possibly damaging Het
Hsdl1 T A 8: 119,565,867 Y203F possibly damaging Het
Ifi204 A T 1: 173,755,668 I328N probably damaging Het
Igsf3 T A 3: 101,439,361 probably null Het
Il1rap T C 16: 26,624,199 I15T probably benign Het
Il23r A T 6: 67,466,316 C268S probably damaging Het
Irx4 A G 13: 73,268,921 T479A probably benign Het
Kcnk7 G A 19: 5,706,324 V193I probably benign Het
Kif13b T G 14: 64,757,453 C885G probably benign Het
Kif21b C A 1: 136,163,100 D1215E probably benign Het
Klhdc2 A G 12: 69,296,962 probably benign Het
Kmt2d G A 15: 98,847,194 probably benign Het
Lama4 A G 10: 39,048,054 N486S probably benign Het
Ldah G A 12: 8,227,237 A58T probably benign Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Luzp1 A G 4: 136,543,397 D977G possibly damaging Het
Mrgpra4 A G 7: 47,981,718 L45P probably damaging Het
Mrps28 C T 3: 8,923,696 G34D possibly damaging Het
Myh8 A G 11: 67,298,358 E1120G probably damaging Het
Myt1l A G 12: 29,832,303 E499G unknown Het
Ncan C T 8: 70,115,025 E146K probably damaging Het
Nlgn1 A T 3: 25,433,794 D763E probably damaging Het
Olfr1259 A T 2: 89,943,803 I104N possibly damaging Het
Olfr1474 C T 19: 13,471,546 T192I probably benign Het
Olfr157 G T 4: 43,836,433 A19D probably benign Het
Olfr23 A T 11: 73,940,552 Y102F possibly damaging Het
Olfr742 T C 14: 50,515,509 F102L probably benign Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pak6 A T 2: 118,694,548 I552F probably damaging Het
Pcbp1 G A 6: 86,524,915 A334V probably damaging Het
Pclaf T C 9: 65,890,780 V32A probably benign Het
Pga5 T A 19: 10,676,689 H50L probably benign Het
Phyhipl A T 10: 70,569,074 D56E probably damaging Het
Pik3ap1 C T 19: 41,281,976 R758H probably benign Het
Plekha1 A G 7: 130,905,364 probably benign Het
Plekhm1 A T 11: 103,387,315 N318K possibly damaging Het
Ppargc1b G A 18: 61,307,654 A731V probably benign Het
Pptc7 T C 5: 122,313,781 V100A possibly damaging Het
Prl7a1 A T 13: 27,633,581 H233Q possibly damaging Het
Prpf40a A G 2: 53,144,849 F776L probably damaging Het
Prrc2c T C 1: 162,705,440 probably benign Het
Psmb1 T C 17: 15,498,262 M1V probably null Het
Ptpn3 A G 4: 57,218,513 F650S possibly damaging Het
Ranbp17 A T 11: 33,404,181 *577R probably null Het
Reln T A 5: 21,971,870 N1933Y probably benign Het
Rgl2 T A 17: 33,937,120 H727Q probably benign Het
Rhpn2 A G 7: 35,371,124 T160A probably damaging Het
Rlf G A 4: 121,147,455 H1443Y probably damaging Het
Rpgrip1l T C 8: 91,280,816 E382G probably damaging Het
Rxrb T C 17: 34,033,588 S50P probably benign Het
Scn4b A T 9: 45,147,758 E109V probably damaging Het
Scrib C T 15: 76,051,753 probably null Het
Slc22a29 A T 19: 8,217,830 V147D probably damaging Het
Slc4a4 A T 5: 88,954,862 E53V probably null Het
Slx4 A G 16: 4,001,199 S37P possibly damaging Het
Spag9 G A 11: 94,122,722 G1127D probably damaging Het
Srek1 T A 13: 103,752,556 probably benign Het
Supt5 G T 7: 28,316,370 P849Q probably damaging Het
Tex14 T C 11: 87,433,813 S2P probably damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tldc1 A C 8: 119,768,143 L292R probably damaging Het
Tll2 A G 19: 41,130,509 V260A possibly damaging Het
Tlr6 A G 5: 64,954,301 V421A probably benign Het
Tmc3 T G 7: 83,615,010 C649G probably damaging Het
Tnn A G 1: 160,120,552 W864R probably damaging Het
Tsc2 A C 17: 24,603,280 V1095G probably benign Het
Vmn1r124 C T 7: 21,260,247 G124D probably damaging Het
Vmn2r116 T C 17: 23,387,164 V350A probably benign Het
Vps13d A G 4: 145,105,898 S2813P possibly damaging Het
Wrap53 T A 11: 69,563,932 M204L possibly damaging Het
Zfp277 A G 12: 40,328,688 V390A possibly damaging Het
Zfp687 A T 3: 95,011,676 S262T probably benign Het
Zfp831 T A 2: 174,705,310 S1429T probably benign Het
Znfx1 G A 2: 167,065,387 probably benign Het
Other mutations in Kcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Kcnt1 APN 2 25892407 missense probably damaging 0.98
IGL01358:Kcnt1 APN 2 25916005 missense probably damaging 1.00
IGL01593:Kcnt1 APN 2 25898754 missense probably damaging 1.00
IGL01779:Kcnt1 APN 2 25900967 missense probably damaging 1.00
IGL01800:Kcnt1 APN 2 25888125 missense probably damaging 1.00
IGL01834:Kcnt1 APN 2 25912719 critical splice donor site probably null
IGL02001:Kcnt1 APN 2 25908152 missense probably damaging 1.00
IGL02061:Kcnt1 APN 2 25900482 critical splice donor site probably null
IGL02121:Kcnt1 APN 2 25901865 missense probably damaging 1.00
IGL02646:Kcnt1 APN 2 25900880 splice site probably benign
IGL02683:Kcnt1 APN 2 25900925 missense possibly damaging 0.85
IGL03028:Kcnt1 APN 2 25909203 critical splice acceptor site probably null
IGL03139:Kcnt1 APN 2 25894468 splice site probably benign
R0070:Kcnt1 UTSW 2 25892362 missense probably benign 0.00
R0070:Kcnt1 UTSW 2 25892362 missense probably benign 0.00
R0149:Kcnt1 UTSW 2 25898264 splice site probably benign
R0294:Kcnt1 UTSW 2 25888110 missense probably damaging 0.99
R0367:Kcnt1 UTSW 2 25907628 missense probably damaging 1.00
R0481:Kcnt1 UTSW 2 25892496 missense probably damaging 0.98
R0666:Kcnt1 UTSW 2 25891243 splice site probably benign
R1364:Kcnt1 UTSW 2 25908094 missense probably damaging 0.99
R1553:Kcnt1 UTSW 2 25900385 missense probably damaging 1.00
R1916:Kcnt1 UTSW 2 25900469 missense probably damaging 1.00
R1999:Kcnt1 UTSW 2 25892360 missense probably benign
R2079:Kcnt1 UTSW 2 25900248 missense possibly damaging 0.48
R2166:Kcnt1 UTSW 2 25891183 splice site probably benign
R2295:Kcnt1 UTSW 2 25900921 missense probably damaging 1.00
R3688:Kcnt1 UTSW 2 25894359 missense probably damaging 1.00
R3820:Kcnt1 UTSW 2 25900892 missense probably damaging 1.00
R3826:Kcnt1 UTSW 2 25915868 critical splice donor site probably null
R3980:Kcnt1 UTSW 2 25893214 missense possibly damaging 0.91
R4031:Kcnt1 UTSW 2 25916048 missense possibly damaging 0.77
R4093:Kcnt1 UTSW 2 25877915 missense probably damaging 0.99
R4361:Kcnt1 UTSW 2 25878032 missense probably benign 0.03
R4367:Kcnt1 UTSW 2 25907626 missense probably damaging 1.00
R4850:Kcnt1 UTSW 2 25908100 missense probably damaging 1.00
R5005:Kcnt1 UTSW 2 25901346 missense probably damaging 1.00
R5223:Kcnt1 UTSW 2 25903422 missense probably benign
R5243:Kcnt1 UTSW 2 25908074 missense probably damaging 1.00
R5323:Kcnt1 UTSW 2 25909277 missense possibly damaging 0.59
R5665:Kcnt1 UTSW 2 25901909 nonsense probably null
R5888:Kcnt1 UTSW 2 25908110 missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25894524 intron probably benign
R5906:Kcnt1 UTSW 2 25898401 missense probably damaging 1.00
R5927:Kcnt1 UTSW 2 25909376 intron probably benign
R6160:Kcnt1 UTSW 2 25892383 missense probably damaging 0.96
R6161:Kcnt1 UTSW 2 25903385 missense probably benign 0.00
R6179:Kcnt1 UTSW 2 25893180 missense probably damaging 1.00
R6222:Kcnt1 UTSW 2 25892510 missense probably damaging 1.00
R6268:Kcnt1 UTSW 2 25903597 splice site probably null
R6336:Kcnt1 UTSW 2 25888755 unclassified probably null
R6395:Kcnt1 UTSW 2 25909239 missense possibly damaging 0.81
R6564:Kcnt1 UTSW 2 25911051 missense probably benign 0.09
R6944:Kcnt1 UTSW 2 25877828 intron probably benign
R7236:Kcnt1 UTSW 2 25909939 splice site probably null
R7308:Kcnt1 UTSW 2 25900463 missense possibly damaging 0.74
R7346:Kcnt1 UTSW 2 25863843 unclassified probably benign
R7419:Kcnt1 UTSW 2 25915999 missense probably benign 0.11
R7461:Kcnt1 UTSW 2 25901346 missense probably benign 0.01
R7470:Kcnt1 UTSW 2 25909833 missense probably damaging 0.96
R7566:Kcnt1 UTSW 2 25916036 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ATCCTATGAACACTCTGATGGCC -3'
(R):5'- ATGTGAGGCAGACACTCCAG -3'

Sequencing Primer
(F):5'- GATGGCCACCCACAATCCTTTG -3'
(R):5'- ACTCAGAACCTGCCTGCCG -3'
Posted On2016-06-15