Incidental Mutation 'R5119:Reln'
ID392805
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Namereelin
Synonyms
MMRRC Submission 042707-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R5119 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21884454-22344702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21971870 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 1933 (N1933Y)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
Predicted Effect probably benign
Transcript: ENSMUST00000062372
AA Change: N1933Y

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: N1933Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161353
Predicted Effect probably benign
Transcript: ENSMUST00000161356
AA Change: N1933Y

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: N1933Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (127/127)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik C A 2: 170,579,585 G125V unknown Het
Actr6 A T 10: 89,725,855 L143Q probably damaging Het
Adamts18 A G 8: 113,699,010 Y1207H probably benign Het
Adamts5 T A 16: 85,899,578 R230S probably benign Het
Adat2 A T 10: 13,556,906 N51Y probably damaging Het
Adgrv1 T C 13: 81,419,427 Y5209C possibly damaging Het
Ahnak G T 19: 9,013,644 M4097I probably benign Het
Akap13 A G 7: 75,687,252 T820A probably damaging Het
Als2cl C T 9: 110,890,819 R492C probably damaging Het
Aox3 G A 1: 58,188,524 probably null Het
Arid4b G A 13: 14,164,281 V446M probably benign Het
Armc2 A G 10: 41,922,148 L794P probably damaging Het
Atp6v0a1 T A 11: 101,020,515 M80K probably benign Het
Aup1 T C 6: 83,055,134 V94A probably damaging Het
Bank1 A T 3: 136,234,682 I180K possibly damaging Het
Becn1 A G 11: 101,291,395 L116P probably damaging Het
Bsg A G 10: 79,710,223 probably benign Het
Camk2a A T 18: 60,943,136 probably benign Het
Ccdc180 A G 4: 45,914,603 E706G possibly damaging Het
Cdk8 A T 5: 146,283,627 probably null Het
Cpne4 A G 9: 104,901,521 probably null Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Cyp2c38 C A 19: 39,460,621 G96V probably damaging Het
Dhx40 A G 11: 86,776,636 I261T probably damaging Het
Dnah10 T C 5: 124,779,258 F2038L probably damaging Het
Dnah7a A T 1: 53,698,692 D27E probably benign Het
Dock10 A T 1: 80,567,994 probably null Het
Dst A T 1: 34,195,969 K3710* probably null Het
Dtl G T 1: 191,541,506 A430D probably damaging Het
Ece2 T C 16: 20,618,631 L241P probably damaging Het
Ecel1 T A 1: 87,151,139 Y526F probably benign Het
Enpp2 T A 15: 54,870,305 R420* probably null Het
Epb41 A C 4: 131,937,436 probably benign Het
Eppin T C 2: 164,589,451 Y85C probably damaging Het
Fam171a2 G A 11: 102,438,733 A400V probably damaging Het
Fam71b G A 11: 46,407,036 G389D probably damaging Het
Fem1c A C 18: 46,506,369 C189G probably damaging Het
Frmd4b A G 6: 97,300,314 V560A probably benign Het
Fsip2 A T 2: 82,988,191 D4756V probably damaging Het
Gabbr1 T C 17: 37,048,438 S102P probably damaging Het
Gm28042 G A 2: 120,034,643 A250T probably damaging Het
Gm42877 T C 14: 54,075,521 probably benign Het
Gm9762 A T 3: 78,966,400 noncoding transcript Het
Gpr183 G T 14: 121,954,863 T82N possibly damaging Het
Gps2 A G 11: 69,914,791 K45R probably benign Het
Gramd2 A G 9: 59,714,320 probably benign Het
Grap2 G A 15: 80,646,144 R155Q possibly damaging Het
Hsdl1 T A 8: 119,565,867 Y203F possibly damaging Het
Ifi204 A T 1: 173,755,668 I328N probably damaging Het
Igsf3 T A 3: 101,439,361 probably null Het
Il1rap T C 16: 26,624,199 I15T probably benign Het
Il23r A T 6: 67,466,316 C268S probably damaging Het
Irx4 A G 13: 73,268,921 T479A probably benign Het
Kcnk7 G A 19: 5,706,324 V193I probably benign Het
Kcnt1 G T 2: 25,909,322 probably benign Het
Kif13b T G 14: 64,757,453 C885G probably benign Het
Kif21b C A 1: 136,163,100 D1215E probably benign Het
Klhdc2 A G 12: 69,296,962 probably benign Het
Kmt2d G A 15: 98,847,194 probably benign Het
Lama4 A G 10: 39,048,054 N486S probably benign Het
Ldah G A 12: 8,227,237 A58T probably benign Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Luzp1 A G 4: 136,543,397 D977G possibly damaging Het
Mrgpra4 A G 7: 47,981,718 L45P probably damaging Het
Mrps28 C T 3: 8,923,696 G34D possibly damaging Het
Myh8 A G 11: 67,298,358 E1120G probably damaging Het
Myt1l A G 12: 29,832,303 E499G unknown Het
Ncan C T 8: 70,115,025 E146K probably damaging Het
Nlgn1 A T 3: 25,433,794 D763E probably damaging Het
Olfr1259 A T 2: 89,943,803 I104N possibly damaging Het
Olfr1474 C T 19: 13,471,546 T192I probably benign Het
Olfr157 G T 4: 43,836,433 A19D probably benign Het
Olfr23 A T 11: 73,940,552 Y102F possibly damaging Het
Olfr742 T C 14: 50,515,509 F102L probably benign Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pak6 A T 2: 118,694,548 I552F probably damaging Het
Pcbp1 G A 6: 86,524,915 A334V probably damaging Het
Pclaf T C 9: 65,890,780 V32A probably benign Het
Pga5 T A 19: 10,676,689 H50L probably benign Het
Phyhipl A T 10: 70,569,074 D56E probably damaging Het
Pik3ap1 C T 19: 41,281,976 R758H probably benign Het
Plekha1 A G 7: 130,905,364 probably benign Het
Plekhm1 A T 11: 103,387,315 N318K possibly damaging Het
Ppargc1b G A 18: 61,307,654 A731V probably benign Het
Pptc7 T C 5: 122,313,781 V100A possibly damaging Het
Prl7a1 A T 13: 27,633,581 H233Q possibly damaging Het
Prpf40a A G 2: 53,144,849 F776L probably damaging Het
Prrc2c T C 1: 162,705,440 probably benign Het
Psmb1 T C 17: 15,498,262 M1V probably null Het
Ptpn3 A G 4: 57,218,513 F650S possibly damaging Het
Ranbp17 A T 11: 33,404,181 *577R probably null Het
Rgl2 T A 17: 33,937,120 H727Q probably benign Het
Rhpn2 A G 7: 35,371,124 T160A probably damaging Het
Rlf G A 4: 121,147,455 H1443Y probably damaging Het
Rpgrip1l T C 8: 91,280,816 E382G probably damaging Het
Rxrb T C 17: 34,033,588 S50P probably benign Het
Scn4b A T 9: 45,147,758 E109V probably damaging Het
Scrib C T 15: 76,051,753 probably null Het
Slc22a29 A T 19: 8,217,830 V147D probably damaging Het
Slc4a4 A T 5: 88,954,862 E53V probably null Het
Slx4 A G 16: 4,001,199 S37P possibly damaging Het
Spag9 G A 11: 94,122,722 G1127D probably damaging Het
Srek1 T A 13: 103,752,556 probably benign Het
Supt5 G T 7: 28,316,370 P849Q probably damaging Het
Tex14 T C 11: 87,433,813 S2P probably damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tldc1 A C 8: 119,768,143 L292R probably damaging Het
Tll2 A G 19: 41,130,509 V260A possibly damaging Het
Tlr6 A G 5: 64,954,301 V421A probably benign Het
Tmc3 T G 7: 83,615,010 C649G probably damaging Het
Tnn A G 1: 160,120,552 W864R probably damaging Het
Tsc2 A C 17: 24,603,280 V1095G probably benign Het
Vmn1r124 C T 7: 21,260,247 G124D probably damaging Het
Vmn2r116 T C 17: 23,387,164 V350A probably benign Het
Vps13d A G 4: 145,105,898 S2813P possibly damaging Het
Wrap53 T A 11: 69,563,932 M204L possibly damaging Het
Zfp277 A G 12: 40,328,688 V390A possibly damaging Het
Zfp687 A T 3: 95,011,676 S262T probably benign Het
Zfp831 T A 2: 174,705,310 S1429T probably benign Het
Znfx1 G A 2: 167,065,387 probably benign Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00091:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00432:Reln APN 5 22010127 missense probably damaging 1.00
IGL00433:Reln APN 5 22045009 missense probably damaging 1.00
IGL00576:Reln APN 5 22154950 missense probably benign 0.01
IGL00755:Reln APN 5 22060380 missense probably damaging 0.98
IGL00777:Reln APN 5 22018850 critical splice donor site probably null
IGL00900:Reln APN 5 21980117 missense probably damaging 0.98
IGL01067:Reln APN 5 21979666 missense probably damaging 1.00
IGL01104:Reln APN 5 21986967 missense probably damaging 0.99
IGL01141:Reln APN 5 21969033 missense probably damaging 1.00
IGL01141:Reln APN 5 21919069 missense probably damaging 1.00
IGL01333:Reln APN 5 22171251 missense probably damaging 0.99
IGL01341:Reln APN 5 21969079 missense probably damaging 1.00
IGL01354:Reln APN 5 21919175 nonsense probably null
IGL01361:Reln APN 5 21919021 missense probably benign 0.06
IGL01446:Reln APN 5 21969317 missense probably damaging 0.99
IGL01448:Reln APN 5 22040405 missense probably benign 0.40
IGL01612:Reln APN 5 21896930 missense probably damaging 0.99
IGL01695:Reln APN 5 21920438 missense probably damaging 1.00
IGL01718:Reln APN 5 21947514 missense possibly damaging 0.60
IGL01749:Reln APN 5 22344246 nonsense probably null
IGL01875:Reln APN 5 21904717 missense probably benign
IGL02013:Reln APN 5 21950879 missense probably damaging 1.00
IGL02031:Reln APN 5 21979016 missense probably damaging 0.99
IGL02186:Reln APN 5 21909958 missense probably damaging 1.00
IGL02228:Reln APN 5 21904731 missense probably damaging 0.99
IGL02248:Reln APN 5 21910992 missense probably damaging 1.00
IGL02336:Reln APN 5 21929134 missense probably damaging 1.00
IGL02352:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02359:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02376:Reln APN 5 22080791 nonsense probably null
IGL02408:Reln APN 5 21901619 missense probably benign 0.44
IGL02415:Reln APN 5 21971951 missense possibly damaging 0.91
IGL02512:Reln APN 5 22040427 missense probably benign 0.00
IGL02540:Reln APN 5 22034752 missense probably damaging 0.96
IGL02624:Reln APN 5 22103357 missense probably benign 0.09
IGL02720:Reln APN 5 21997941 missense probably damaging 0.99
IGL02894:Reln APN 5 21885548 missense possibly damaging 0.72
IGL02999:Reln APN 5 21995365 missense probably damaging 1.00
IGL03125:Reln APN 5 21910844 missense probably damaging 1.00
IGL03298:Reln APN 5 21910836 missense probably damaging 0.99
fishing UTSW 5 21896841 missense probably damaging 1.00
P0020:Reln UTSW 5 22106060 missense possibly damaging 0.91
R0018:Reln UTSW 5 21925371 missense probably benign 0.01
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0127:Reln UTSW 5 22004136 missense probably damaging 1.00
R0135:Reln UTSW 5 22128649 missense probably damaging 0.99
R0144:Reln UTSW 5 21948449 missense probably damaging 0.97
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0266:Reln UTSW 5 21988776 missense probably damaging 1.00
R0269:Reln UTSW 5 21920537 missense probably damaging 1.00
R0280:Reln UTSW 5 22227513 splice site probably benign
R0333:Reln UTSW 5 21929242 missense probably damaging 0.97
R0357:Reln UTSW 5 21950822 missense probably damaging 1.00
R0359:Reln UTSW 5 22048800 missense probably damaging 0.98
R0506:Reln UTSW 5 21920496 missense probably damaging 0.97
R0534:Reln UTSW 5 21947408 missense probably damaging 0.99
R0535:Reln UTSW 5 22051276 splice site probably benign
R0541:Reln UTSW 5 21980109 missense possibly damaging 0.88
R0615:Reln UTSW 5 22010150 missense probably benign 0.36
R0617:Reln UTSW 5 21920537 missense probably damaging 1.00
R0634:Reln UTSW 5 22018869 missense probably damaging 1.00
R0653:Reln UTSW 5 21913230 missense probably benign 0.44
R0704:Reln UTSW 5 21896811 missense probably damaging 0.99
R0706:Reln UTSW 5 21896811 missense probably damaging 0.99
R0959:Reln UTSW 5 22227628 missense probably damaging 0.96
R1066:Reln UTSW 5 22034664 missense probably damaging 1.00
R1110:Reln UTSW 5 22034775 missense probably benign
R1163:Reln UTSW 5 21899029 missense probably benign 0.03
R1222:Reln UTSW 5 21986955 missense probably null 0.97
R1226:Reln UTSW 5 21910866 missense probably damaging 1.00
R1440:Reln UTSW 5 22128602 splice site probably benign
R1532:Reln UTSW 5 22034744 missense probably damaging 0.99
R1552:Reln UTSW 5 21960378 missense probably benign 0.01
R1565:Reln UTSW 5 21925213 missense probably benign 0.05
R1618:Reln UTSW 5 22060368 missense probably benign 0.01
R1636:Reln UTSW 5 21998683 missense probably damaging 0.99
R1664:Reln UTSW 5 21929086 missense probably damaging 1.00
R1716:Reln UTSW 5 21955095 missense probably damaging 0.98
R1759:Reln UTSW 5 22010289 missense probably damaging 0.99
R1835:Reln UTSW 5 21979002 missense probably damaging 1.00
R1907:Reln UTSW 5 22044962 critical splice donor site probably null
R1991:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2046:Reln UTSW 5 21942627 missense probably benign 0.01
R2072:Reln UTSW 5 21919177 missense probably damaging 1.00
R2103:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2119:Reln UTSW 5 22019000 missense probably damaging 1.00
R2120:Reln UTSW 5 21969085 missense probably damaging 1.00
R2216:Reln UTSW 5 22048005 missense probably benign 0.30
R2219:Reln UTSW 5 21972047 missense possibly damaging 0.88
R2228:Reln UTSW 5 21987078 missense possibly damaging 0.69
R2306:Reln UTSW 5 21896786 missense probably damaging 1.00
R2316:Reln UTSW 5 22154956 missense probably benign 0.00
R2321:Reln UTSW 5 21915020 missense probably damaging 0.99
R2512:Reln UTSW 5 21979690 missense possibly damaging 0.89
R2519:Reln UTSW 5 22344369 missense unknown
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R3195:Reln UTSW 5 22040420 missense possibly damaging 0.72
R3545:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3546:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3547:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3706:Reln UTSW 5 21995589 splice site probably benign
R3713:Reln UTSW 5 21904734 missense probably damaging 0.99
R3770:Reln UTSW 5 21948566 missense probably damaging 1.00
R3836:Reln UTSW 5 21911014 missense probably damaging 1.00
R3887:Reln UTSW 5 21910849 missense possibly damaging 0.92
R3972:Reln UTSW 5 21979001 missense probably damaging 0.99
R3975:Reln UTSW 5 21995366 missense possibly damaging 0.57
R4022:Reln UTSW 5 22227630 missense probably benign 0.45
R4044:Reln UTSW 5 22128632 missense possibly damaging 0.82
R4107:Reln UTSW 5 22034584 missense probably damaging 1.00
R4297:Reln UTSW 5 21920487 missense probably damaging 0.99
R4298:Reln UTSW 5 21920487 missense probably damaging 0.99
R4299:Reln UTSW 5 21920487 missense probably damaging 0.99
R4518:Reln UTSW 5 21901743 missense probably benign 0.44
R4615:Reln UTSW 5 21972872 missense possibly damaging 0.95
R4713:Reln UTSW 5 22152463 missense probably benign 0.17
R4720:Reln UTSW 5 22286896 missense possibly damaging 0.71
R4721:Reln UTSW 5 21919222 missense probably damaging 0.99
R4771:Reln UTSW 5 22049700 missense probably damaging 1.00
R4794:Reln UTSW 5 22344185 missense probably damaging 0.98
R4840:Reln UTSW 5 22018846 splice site probably null
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4896:Reln UTSW 5 21955238 missense probably damaging 1.00
R4908:Reln UTSW 5 21979720 missense probably benign 0.02
R4912:Reln UTSW 5 21925193 missense probably benign 0.29
R4922:Reln UTSW 5 21995587 critical splice acceptor site probably null
R4975:Reln UTSW 5 21960426 missense probably damaging 1.00
R4976:Reln UTSW 5 21971870 missense probably benign 0.05
R5020:Reln UTSW 5 22034638 missense probably damaging 1.00
R5037:Reln UTSW 5 21948512 missense probably damaging 1.00
R5082:Reln UTSW 5 21896077 missense probably benign 0.00
R5125:Reln UTSW 5 21913241 missense possibly damaging 0.78
R5137:Reln UTSW 5 21955181 missense probably damaging 1.00
R5152:Reln UTSW 5 21948629 missense probably damaging 1.00
R5154:Reln UTSW 5 21988765 missense probably damaging 0.99
R5259:Reln UTSW 5 22103397 missense possibly damaging 0.83
R5283:Reln UTSW 5 22011163 missense probably damaging 1.00
R5386:Reln UTSW 5 22039529 missense probably benign
R5400:Reln UTSW 5 21979714 missense probably damaging 1.00
R5478:Reln UTSW 5 22004203 missense probably benign 0.00
R5514:Reln UTSW 5 21971885 missense possibly damaging 0.93
R5529:Reln UTSW 5 21932715 missense possibly damaging 0.71
R5611:Reln UTSW 5 22039665 nonsense probably null
R5648:Reln UTSW 5 21998572 missense probably benign 0.04
R5649:Reln UTSW 5 21901625 missense probably benign 0.33
R5744:Reln UTSW 5 22106083 missense probably null 0.39
R5782:Reln UTSW 5 22018056 missense probably benign 0.01
R5815:Reln UTSW 5 21947433 missense probably damaging 0.99
R5838:Reln UTSW 5 21899113 missense probably damaging 0.97
R6162:Reln UTSW 5 21911050 missense probably damaging 1.00
R6219:Reln UTSW 5 21948596 missense probably damaging 1.00
R6259:Reln UTSW 5 22060333 missense probably damaging 0.99
R6279:Reln UTSW 5 21896841 missense probably damaging 1.00
R6299:Reln UTSW 5 22286944 missense possibly damaging 0.71
R6300:Reln UTSW 5 21896841 missense probably damaging 1.00
R6314:Reln UTSW 5 22152484 nonsense probably null
R6351:Reln UTSW 5 21901663 nonsense probably null
R6369:Reln UTSW 5 22051361 missense probably benign 0.03
R6371:Reln UTSW 5 21995513 missense probably benign
R6374:Reln UTSW 5 22080714 missense probably benign 0.06
R6425:Reln UTSW 5 21911020 nonsense probably null
R6442:Reln UTSW 5 21932776 missense probably benign
R6445:Reln UTSW 5 21919214 missense probably benign 0.05
R6554:Reln UTSW 5 21896840 missense probably damaging 1.00
R6641:Reln UTSW 5 21929134 missense probably damaging 1.00
R6768:Reln UTSW 5 21978907 missense probably damaging 0.99
R6859:Reln UTSW 5 22034570 missense probably damaging 1.00
R6896:Reln UTSW 5 21899179 missense probably benign 0.18
R6932:Reln UTSW 5 21985857 missense probably benign 0.00
R6948:Reln UTSW 5 21972035 missense probably damaging 1.00
R6959:Reln UTSW 5 21976564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAGATGTCTCAGCCAAATG -3'
(R):5'- AGCTTGCTTTATGCCCCTAG -3'

Sequencing Primer
(F):5'- CAAATGATGGCAAACTAAACCAAG -3'
(R):5'- TTATGCCCCTAGGTACCCCAGAG -3'
Posted On2016-06-15