Incidental Mutation 'R5120:Lhx8'
ID392907
Institutional Source Beutler Lab
Gene Symbol Lhx8
Ensembl Gene ENSMUSG00000096225
Gene NameLIM homeobox protein 8
SynonymsL3, Lhx7
MMRRC Submission 042708-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R5120 (G1)
Quality Score215
Status Validated
Chromosome3
Chromosomal Location154306294-154330659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154311695 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 301 (H301R)
Ref Sequence ENSEMBL: ENSMUSP00000136047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177846] [ENSMUST00000204171] [ENSMUST00000205251]
Predicted Effect probably damaging
Transcript: ENSMUST00000176163
AA Change: H270R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134853
Gene: ENSMUSG00000096225
AA Change: H270R

DomainStartEndE-ValueType
low complexity region 36 56 N/A INTRINSIC
LIM 64 117 2.38e-12 SMART
LIM 125 179 2.06e-16 SMART
HOX 215 277 2.7e-23 SMART
low complexity region 279 290 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177846
AA Change: H301R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136047
Gene: ENSMUSG00000096225
AA Change: H301R

DomainStartEndE-ValueType
low complexity region 67 87 N/A INTRINSIC
LIM 95 148 2.38e-12 SMART
LIM 156 210 2.06e-16 SMART
HOX 246 308 2.7e-23 SMART
low complexity region 310 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204171
SMART Domains Protein: ENSMUSP00000144708
Gene: ENSMUSG00000096225

DomainStartEndE-ValueType
low complexity region 11 31 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205251
AA Change: H270R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145485
Gene: ENSMUSG00000096225
AA Change: H270R

DomainStartEndE-ValueType
low complexity region 36 56 N/A INTRINSIC
LIM 64 117 2.38e-12 SMART
LIM 125 179 2.06e-16 SMART
HOX 215 277 2.7e-23 SMART
low complexity region 279 290 N/A INTRINSIC
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LIM homeobox family of proteins, which are involved in patterning and differentiation of various tissue types. These proteins contain two tandemly repeated cysteine-rich double-zinc finger motifs known as LIM domains, in addition to a DNA-binding homeodomain. This family member is a transcription factor that plays a role in tooth morphogenesis. It is also involved in oogenesis and in neuronal differentiation. This gene is a candidate gene for cleft palate, and it is also associated with odontoma formation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice exhibit partial penetrance of a cleft secondary palate and neonatal lethality; those without cleft palate survive to adulthood. All homozygous null mice have decreased or absent forebrain cholinergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,210,235 H225R probably benign Het
Abcc9 T A 6: 142,656,618 I690F probably benign Het
Acp4 A T 7: 44,256,971 D52E probably damaging Het
Adam17 T C 12: 21,343,019 probably benign Het
Adamts15 T C 9: 30,921,576 E221G probably damaging Het
Aoc2 A G 11: 101,325,714 T208A probably benign Het
Apoa4 T G 9: 46,242,737 I212S probably damaging Het
Bptf A T 11: 107,073,385 M1598K probably damaging Het
Camsap3 G A 8: 3,600,680 R209Q probably damaging Het
Ccdc171 C A 4: 83,558,526 probably benign Het
Celsr2 G C 3: 108,393,120 P2875A probably benign Het
Cenpb A G 2: 131,179,818 V20A probably benign Het
Cfap61 A T 2: 146,143,160 K975* probably null Het
Col9a2 G T 4: 121,039,772 A20S unknown Het
Crnn A T 3: 93,148,896 I330F probably benign Het
Csf3r C A 4: 126,035,827 P381Q probably benign Het
Csmd3 G A 15: 48,673,495 Q104* probably null Het
Ctnna1 G A 18: 35,182,554 probably null Het
Cwf19l2 C T 9: 3,418,761 Q183* probably null Het
Ddx60 T C 8: 61,945,906 Y220H probably benign Het
Dhh T C 15: 98,898,157 Q39R probably benign Het
Dynlrb2 T A 8: 116,515,698 I89N possibly damaging Het
Dytn T C 1: 63,623,043 E645G probably benign Het
Efcab7 A G 4: 99,897,491 T287A probably damaging Het
Eogt A G 6: 97,134,315 V195A probably benign Het
Ep400 G T 5: 110,756,358 P125Q probably damaging Het
Fasn A G 11: 120,811,391 V1815A probably benign Het
Gm4788 T C 1: 139,753,103 S226G probably benign Het
Gm5866 T C 5: 52,582,882 noncoding transcript Het
Gm8674 C A 13: 49,901,948 noncoding transcript Het
Gpat4 G T 8: 23,180,202 H270Q possibly damaging Het
Grik5 A G 7: 25,010,640 L890P probably damaging Het
Gsap A G 5: 21,269,936 N500S probably damaging Het
H2-M10.1 T C 17: 36,325,156 D173G probably benign Het
Igfn1 T A 1: 135,973,502 I413F possibly damaging Het
Ighv1-52 G T 12: 115,145,786 H17N probably benign Het
Kcnu1 T A 8: 25,934,488 D270E possibly damaging Het
Kif16b A C 2: 142,848,339 N274K probably damaging Het
Klk1b11 C T 7: 43,999,022 T151I probably benign Het
Krtap13 A G 16: 88,751,570 F10S probably damaging Het
Large1 A T 8: 72,859,341 I379N probably damaging Het
Lrriq3 T C 3: 155,129,384 V252A probably benign Het
Lysmd3 T A 13: 81,669,192 I96N probably damaging Het
Mpeg1 C T 19: 12,461,429 Q84* probably null Het
Myoz1 C T 14: 20,650,654 G165D probably benign Het
Myt1 G A 2: 181,797,620 V312I probably benign Het
Ndufb7 T C 8: 83,566,977 probably benign Het
Numa1 C T 7: 101,977,437 T10M probably damaging Het
Olfr1285 T C 2: 111,409,240 noncoding transcript Het
Olfr130 A T 17: 38,067,266 I32F probably damaging Het
Olfr1316 A T 2: 112,130,558 D84E probably damaging Het
Olfr149 T A 9: 39,702,070 H233L probably benign Het
Olfr390 A C 11: 73,786,964 I9L probably benign Het
Osmr A T 15: 6,827,275 S464T probably benign Het
Pak7 G A 2: 136,083,229 H718Y probably damaging Het
Pan2 T A 10: 128,314,995 probably null Het
Pik3r4 T C 9: 105,669,009 S853P probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polr3gl T A 3: 96,578,479 probably benign Het
Psd2 G A 18: 35,979,810 R186Q possibly damaging Het
Psd4 T C 2: 24,405,438 V868A probably benign Het
Ralgapa2 G T 2: 146,412,084 T852K probably benign Het
Rbm43 T C 2: 51,932,423 probably benign Het
Rps6kl1 C A 12: 85,139,348 G329C probably damaging Het
Scaf11 T C 15: 96,419,542 T714A probably benign Het
Selenoo C A 15: 89,094,305 N310K possibly damaging Het
Sepsecs T C 5: 52,660,661 Q258R probably damaging Het
Sgcz T C 8: 37,526,266 S226G probably benign Het
Slfn5 A G 11: 82,960,928 K627E probably damaging Het
Sos1 A T 17: 80,408,248 F1027I probably damaging Het
Ssh1 C G 5: 113,957,398 V228L possibly damaging Het
Sugp1 C A 8: 70,048,667 P65T probably benign Het
Tas2r106 T A 6: 131,678,816 N24I probably damaging Het
Tex10 T C 4: 48,459,272 E534G possibly damaging Het
Tmem182 C T 1: 40,854,901 T192I possibly damaging Het
Traf7 T A 17: 24,518,744 K51* probably null Het
Trap1 C A 16: 4,044,088 R604L probably damaging Het
Trim6 T A 7: 104,228,240 L179Q probably damaging Het
Ubfd1 T C 7: 122,071,750 S264P probably damaging Het
Upk3bl T C 5: 136,064,191 probably benign Het
Wdfy3 T A 5: 101,868,106 Q2601L possibly damaging Het
Wdr89 A G 12: 75,632,638 Y281H probably damaging Het
Zfp286 A T 11: 62,780,725 M174K probably benign Het
Zmym1 T C 4: 127,051,437 probably null Het
Other mutations in Lhx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01806:Lhx8 APN 3 154322355 missense probably damaging 1.00
IGL01991:Lhx8 APN 3 154324554 missense probably damaging 1.00
R0463:Lhx8 UTSW 3 154328171 splice site probably null
R1449:Lhx8 UTSW 3 154328105 nonsense probably null
R1837:Lhx8 UTSW 3 154328055 missense possibly damaging 0.94
R2272:Lhx8 UTSW 3 154316762 missense probably damaging 1.00
R3196:Lhx8 UTSW 3 154330288 missense probably benign 0.05
R4900:Lhx8 UTSW 3 154330288 missense probably benign 0.01
R5223:Lhx8 UTSW 3 154321644 missense probably damaging 1.00
R5587:Lhx8 UTSW 3 154311679 missense probably damaging 0.99
R6046:Lhx8 UTSW 3 154321703 missense probably damaging 1.00
R7155:Lhx8 UTSW 3 154324584 missense possibly damaging 0.82
X0028:Lhx8 UTSW 3 154324575 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCAGCTGTGCTACCTACCA -3'
(R):5'- CTCCAACCCTTGAACTTCTTAGGAC -3'

Sequencing Primer
(F):5'- TACCATCCATGTATGAGTGCAGCG -3'
(R):5'- TTGGGATTACAGGCATGCACC -3'
Posted On2016-06-15