Incidental Mutation 'R5120:Trim6'
ID392928
Institutional Source Beutler Lab
Gene Symbol Trim6
Ensembl Gene ENSMUSG00000072244
Gene Nametripartite motif-containing 6
SynonymsC430046K18Rik, D7Ertd684e
MMRRC Submission 042708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R5120 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104218793-104235152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104228240 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 179 (L179Q)
Ref Sequence ENSEMBL: ENSMUSP00000149805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098180] [ENSMUST00000128493] [ENSMUST00000144455] [ENSMUST00000153324] [ENSMUST00000214578]
Predicted Effect probably damaging
Transcript: ENSMUST00000097023
AA Change: L179Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094787
Gene: ENSMUSG00000072244
AA Change: L179Q

DomainStartEndE-ValueType
RING 15 59 8.16e-10 SMART
PDB:2YRG|A 83 105 2e-8 PDB
coiled coil region 107 194 N/A INTRINSIC
PRY 274 325 5.31e-9 SMART
Pfam:SPRY 328 456 2.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098180
AA Change: L205Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095782
Gene: ENSMUSG00000072244
AA Change: L205Q

DomainStartEndE-ValueType
RING 15 59 8.16e-10 SMART
BBOX 92 133 8.87e-11 SMART
low complexity region 194 211 N/A INTRINSIC
PRY 300 351 5.31e-9 SMART
Pfam:SPRY 354 482 9.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128493
SMART Domains Protein: ENSMUSP00000118859
Gene: ENSMUSG00000072244

DomainStartEndE-ValueType
RING 15 59 8.16e-10 SMART
Pfam:zf-B_box 93 125 1.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144455
SMART Domains Protein: ENSMUSP00000116233
Gene: ENSMUSG00000072244

DomainStartEndE-ValueType
RING 15 59 8.16e-10 SMART
Blast:BBOX 92 113 6e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144538
Predicted Effect probably benign
Transcript: ENSMUST00000153324
SMART Domains Protein: ENSMUSP00000119932
Gene: ENSMUSG00000072244

DomainStartEndE-ValueType
RING 15 59 8.16e-10 SMART
BBOX 92 133 8.87e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000214578
AA Change: L179Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, B-box type 1 and B-box type 2 domain, and a coiled-coil region. The protein localizes to the nucleus, but its specific function has not been identified. This gene is mapped to chromosome 11p15, where it resides within a TRIM gene cluster. Alternative splicing results in multiple transcript variants. A read-through transcript from this gene into the downstream TRIM34 gene has also been observed, which results in a fusion product from these neighboring family members. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,210,235 H225R probably benign Het
Abcc9 T A 6: 142,656,618 I690F probably benign Het
Acp4 A T 7: 44,256,971 D52E probably damaging Het
Adam17 T C 12: 21,343,019 probably benign Het
Adamts15 T C 9: 30,921,576 E221G probably damaging Het
Aoc2 A G 11: 101,325,714 T208A probably benign Het
Apoa4 T G 9: 46,242,737 I212S probably damaging Het
Bptf A T 11: 107,073,385 M1598K probably damaging Het
Camsap3 G A 8: 3,600,680 R209Q probably damaging Het
Ccdc171 C A 4: 83,558,526 probably benign Het
Celsr2 G C 3: 108,393,120 P2875A probably benign Het
Cenpb A G 2: 131,179,818 V20A probably benign Het
Cfap61 A T 2: 146,143,160 K975* probably null Het
Col9a2 G T 4: 121,039,772 A20S unknown Het
Crnn A T 3: 93,148,896 I330F probably benign Het
Csf3r C A 4: 126,035,827 P381Q probably benign Het
Csmd3 G A 15: 48,673,495 Q104* probably null Het
Ctnna1 G A 18: 35,182,554 probably null Het
Cwf19l2 C T 9: 3,418,761 Q183* probably null Het
Ddx60 T C 8: 61,945,906 Y220H probably benign Het
Dhh T C 15: 98,898,157 Q39R probably benign Het
Dynlrb2 T A 8: 116,515,698 I89N possibly damaging Het
Dytn T C 1: 63,623,043 E645G probably benign Het
Efcab7 A G 4: 99,897,491 T287A probably damaging Het
Eogt A G 6: 97,134,315 V195A probably benign Het
Ep400 G T 5: 110,756,358 P125Q probably damaging Het
Fasn A G 11: 120,811,391 V1815A probably benign Het
Gm4788 T C 1: 139,753,103 S226G probably benign Het
Gm5866 T C 5: 52,582,882 noncoding transcript Het
Gm8674 C A 13: 49,901,948 noncoding transcript Het
Gpat4 G T 8: 23,180,202 H270Q possibly damaging Het
Grik5 A G 7: 25,010,640 L890P probably damaging Het
Gsap A G 5: 21,269,936 N500S probably damaging Het
H2-M10.1 T C 17: 36,325,156 D173G probably benign Het
Igfn1 T A 1: 135,973,502 I413F possibly damaging Het
Ighv1-52 G T 12: 115,145,786 H17N probably benign Het
Kcnu1 T A 8: 25,934,488 D270E possibly damaging Het
Kif16b A C 2: 142,848,339 N274K probably damaging Het
Klk1b11 C T 7: 43,999,022 T151I probably benign Het
Krtap13 A G 16: 88,751,570 F10S probably damaging Het
Large1 A T 8: 72,859,341 I379N probably damaging Het
Lhx8 T C 3: 154,311,695 H301R probably damaging Het
Lrriq3 T C 3: 155,129,384 V252A probably benign Het
Lysmd3 T A 13: 81,669,192 I96N probably damaging Het
Mpeg1 C T 19: 12,461,429 Q84* probably null Het
Myoz1 C T 14: 20,650,654 G165D probably benign Het
Myt1 G A 2: 181,797,620 V312I probably benign Het
Ndufb7 T C 8: 83,566,977 probably benign Het
Numa1 C T 7: 101,977,437 T10M probably damaging Het
Olfr1285 T C 2: 111,409,240 noncoding transcript Het
Olfr130 A T 17: 38,067,266 I32F probably damaging Het
Olfr1316 A T 2: 112,130,558 D84E probably damaging Het
Olfr149 T A 9: 39,702,070 H233L probably benign Het
Olfr390 A C 11: 73,786,964 I9L probably benign Het
Osmr A T 15: 6,827,275 S464T probably benign Het
Pak7 G A 2: 136,083,229 H718Y probably damaging Het
Pan2 T A 10: 128,314,995 probably null Het
Pik3r4 T C 9: 105,669,009 S853P probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polr3gl T A 3: 96,578,479 probably benign Het
Psd2 G A 18: 35,979,810 R186Q possibly damaging Het
Psd4 T C 2: 24,405,438 V868A probably benign Het
Ralgapa2 G T 2: 146,412,084 T852K probably benign Het
Rbm43 T C 2: 51,932,423 probably benign Het
Rps6kl1 C A 12: 85,139,348 G329C probably damaging Het
Scaf11 T C 15: 96,419,542 T714A probably benign Het
Selenoo C A 15: 89,094,305 N310K possibly damaging Het
Sepsecs T C 5: 52,660,661 Q258R probably damaging Het
Sgcz T C 8: 37,526,266 S226G probably benign Het
Slfn5 A G 11: 82,960,928 K627E probably damaging Het
Sos1 A T 17: 80,408,248 F1027I probably damaging Het
Ssh1 C G 5: 113,957,398 V228L possibly damaging Het
Sugp1 C A 8: 70,048,667 P65T probably benign Het
Tas2r106 T A 6: 131,678,816 N24I probably damaging Het
Tex10 T C 4: 48,459,272 E534G possibly damaging Het
Tmem182 C T 1: 40,854,901 T192I possibly damaging Het
Traf7 T A 17: 24,518,744 K51* probably null Het
Trap1 C A 16: 4,044,088 R604L probably damaging Het
Ubfd1 T C 7: 122,071,750 S264P probably damaging Het
Upk3bl T C 5: 136,064,191 probably benign Het
Wdfy3 T A 5: 101,868,106 Q2601L possibly damaging Het
Wdr89 A G 12: 75,632,638 Y281H probably damaging Het
Zfp286 A T 11: 62,780,725 M174K probably benign Het
Zmym1 T C 4: 127,051,437 probably null Het
Other mutations in Trim6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00828:Trim6 APN 7 104230743 missense probably benign 0.00
IGL02493:Trim6 APN 7 104232640 missense probably benign 0.04
IGL02517:Trim6 APN 7 104232357 splice site probably benign
R0026:Trim6 UTSW 7 104225809 synonymous probably null
R1505:Trim6 UTSW 7 104232564 missense probably damaging 1.00
R1711:Trim6 UTSW 7 104232837 missense probably damaging 1.00
R2507:Trim6 UTSW 7 104228185 missense probably damaging 1.00
R3919:Trim6 UTSW 7 104232850 missense probably damaging 1.00
R4731:Trim6 UTSW 7 104232648 missense probably damaging 1.00
R4732:Trim6 UTSW 7 104232648 missense probably damaging 1.00
R4733:Trim6 UTSW 7 104232648 missense probably damaging 1.00
R4858:Trim6 UTSW 7 104232485 nonsense probably null
R7147:Trim6 UTSW 7 104225570 missense probably benign 0.00
R7372:Trim6 UTSW 7 104232636 missense probably benign 0.04
R7407:Trim6 UTSW 7 104225901 missense probably damaging 1.00
R7526:Trim6 UTSW 7 104232832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACAGTTCCCACAGGCTTG -3'
(R):5'- AACTGTCTTAGACTTCCTGTGGC -3'

Sequencing Primer
(F):5'- GAAGCAGTATGCAGCTGCTTC -3'
(R):5'- GTGGCCTCCTCATAGCTCAATAC -3'
Posted On2016-06-15