Incidental Mutation 'R0443:Twnk'
ID39297
Institutional Source Beutler Lab
Gene Symbol Twnk
Ensembl Gene ENSMUSG00000025209
Gene Nametwinkle mtDNA helicase
Synonymstwinkle, Twinl, Peo1, D19Ertd626e
MMRRC Submission 038644-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0443 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location45006558-45012762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45008139 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 337 (G337V)
Ref Sequence ENSEMBL: ENSMUSP00000026227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026225] [ENSMUST00000026227] [ENSMUST00000097715] [ENSMUST00000130549] [ENSMUST00000179305]
Predicted Effect probably benign
Transcript: ENSMUST00000026225
SMART Domains Protein: ENSMUSP00000026225
Gene: ENSMUSG00000025207

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000026227
AA Change: G337V

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026227
Gene: ENSMUSG00000025209
AA Change: G337V

DomainStartEndE-ValueType
low complexity region 213 224 N/A INTRINSIC
Blast:TOPRIM 260 331 8e-16 BLAST
Pfam:AAA_25 377 565 5.6e-25 PFAM
Pfam:DnaB_C 390 631 6.7e-17 PFAM
Pfam:KaiC 394 628 2.6e-11 PFAM
low complexity region 650 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097715
SMART Domains Protein: ENSMUSP00000095322
Gene: ENSMUSG00000025208

DomainStartEndE-ValueType
L51_S25_CI-B8 35 108 1.61e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130549
SMART Domains Protein: ENSMUSP00000138321
Gene: ENSMUSG00000025207

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179305
SMART Domains Protein: ENSMUSP00000137395
Gene: ENSMUSG00000025207

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hexameric DNA helicase which unwinds short stretches of double-stranded DNA in the 5' to 3' direction and, along with mitochondrial single-stranded DNA binding protein and mtDNA polymerase gamma, is thought to play a key role in mtDNA replication. The protein localizes to the mitochondrial matrix and mitochondrial nucleoids. Mutations in this gene cause infantile onset spinocerebellar ataxia (IOSCA) and progressive external ophthalmoplegia (PEO) and are also associated with several mitochondrial depletion syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous embryos display abnormal development. Embryos die around E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3b G T 5: 25,848,411 R246L probably damaging Het
Adam18 T C 8: 24,629,637 probably null Het
Ankhd1 A G 18: 36,644,599 S1612G possibly damaging Het
Caskin1 C T 17: 24,505,400 A1054V probably damaging Het
Casz1 T C 4: 148,948,911 V1380A possibly damaging Het
Cnot6l T G 5: 96,091,745 probably benign Het
Crat T C 2: 30,403,628 probably benign Het
Ctgf T C 10: 24,595,803 probably benign Het
Cux2 C T 5: 121,887,437 R56H possibly damaging Het
Dst A G 1: 34,294,550 probably null Het
Dync2h1 G T 9: 7,167,244 probably null Het
Epg5 T C 18: 77,955,903 probably benign Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam20b A T 1: 156,681,453 D396E probably benign Het
Gapvd1 A G 2: 34,704,621 probably benign Het
Golga1 A T 2: 39,018,441 S749T probably damaging Het
Gsdma2 C T 11: 98,657,688 T255I probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Itgam C T 7: 128,081,634 A245V probably damaging Het
Kcnk15 A G 2: 163,858,323 T161A probably benign Het
Map3k19 A T 1: 127,822,415 N1066K probably benign Het
Ms4a6b A G 19: 11,521,680 I53V possibly damaging Het
Mtf1 C T 4: 124,824,282 probably benign Het
Neb T C 2: 52,161,477 probably null Het
Nop9 A G 14: 55,753,748 S621G probably benign Het
Olfr378 A G 11: 73,425,755 V76A probably damaging Het
Olfr459 T A 6: 41,771,895 I135F possibly damaging Het
Olfr484 A G 7: 108,124,816 V149A probably benign Het
Pacs1 A T 19: 5,272,583 Y102* probably null Het
Pcdhb10 A C 18: 37,412,432 D187A probably damaging Het
Pih1d2 A G 9: 50,621,103 R170G possibly damaging Het
Pikfyve A G 1: 65,196,706 H179R probably damaging Het
Pknox1 A G 17: 31,592,219 S156G probably damaging Het
Prkcz T A 4: 155,269,140 D250V probably damaging Het
Psg16 T A 7: 17,095,163 I224N probably benign Het
Slc25a40 T A 5: 8,447,348 S229T probably benign Het
Slc43a2 T C 11: 75,544,667 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tas2r129 G T 6: 132,951,196 C32F probably benign Het
Tfap2d C T 1: 19,104,367 R15C possibly damaging Het
Tonsl T C 15: 76,639,684 S39G probably benign Het
Trove2 A G 1: 143,765,923 probably benign Het
Trpc2 A G 7: 102,093,520 probably benign Het
Ttc17 A G 2: 94,378,094 F144S probably benign Het
Uvssa A G 5: 33,388,824 R180G possibly damaging Het
Vmn1r197 T A 13: 22,328,071 I54K possibly damaging Het
Vmn1r71 G A 7: 10,748,311 T84I probably benign Het
Zbtb49 T C 5: 38,200,830 E693G probably benign Het
Other mutations in Twnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Twnk APN 19 45007626 missense probably benign 0.03
IGL01367:Twnk APN 19 45011651 missense possibly damaging 0.92
IGL01736:Twnk APN 19 45010188 missense probably damaging 0.97
IGL02724:Twnk APN 19 45008118 missense probably damaging 0.99
IGL03368:Twnk APN 19 45010492 missense probably damaging 0.99
R0121:Twnk UTSW 19 45009265 unclassified probably benign
R0389:Twnk UTSW 19 45008139 missense possibly damaging 0.67
R0427:Twnk UTSW 19 45007587 missense probably benign 0.00
R0501:Twnk UTSW 19 45007746 missense probably damaging 1.00
R0791:Twnk UTSW 19 45010254 unclassified probably benign
R1193:Twnk UTSW 19 45007790 missense probably damaging 1.00
R1470:Twnk UTSW 19 45009381 missense probably damaging 1.00
R1470:Twnk UTSW 19 45009381 missense probably damaging 1.00
R1487:Twnk UTSW 19 45008376 critical splice donor site probably null
R1556:Twnk UTSW 19 45009411 missense possibly damaging 0.80
R3895:Twnk UTSW 19 45007451 missense probably damaging 0.98
R5652:Twnk UTSW 19 45007293 missense possibly damaging 0.85
R6373:Twnk UTSW 19 45009381 missense probably damaging 1.00
R6595:Twnk UTSW 19 45010492 missense probably damaging 0.99
R6880:Twnk UTSW 19 45007416 missense probably benign
R7349:Twnk UTSW 19 45010161 missense possibly damaging 0.65
R7401:Twnk UTSW 19 45011780 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GGCGATTCAGTGTCCGCTATCTTC -3'
(R):5'- AGCCGCTTGCTCTACATTTGACAG -3'

Sequencing Primer
(F):5'- CTCAGGATTACGTGGCCTGAAG -3'
(R):5'- CTACATTTGACAGTTCTCCTAAAACC -3'
Posted On2013-05-23