Incidental Mutation 'R5121:Acvr1c'
ID392980
Institutional Source Beutler Lab
Gene Symbol Acvr1c
Ensembl Gene ENSMUSG00000026834
Gene Nameactivin A receptor, type IC
SynonymsALK7, Alk-7
MMRRC Submission 042709-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5121 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location58267453-58357895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58281650 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 234 (I234T)
Ref Sequence ENSEMBL: ENSMUSP00000108226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028178] [ENSMUST00000100085] [ENSMUST00000112607] [ENSMUST00000112608]
Predicted Effect probably damaging
Transcript: ENSMUST00000028178
AA Change: I391T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028178
Gene: ENSMUSG00000026834
AA Change: I391T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 3.1e-13 PFAM
transmembrane domain 114 136 N/A INTRINSIC
GS 165 195 1.07e-13 SMART
Blast:TyrKc 201 472 3e-28 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000100085
AA Change: I261T
SMART Domains Protein: ENSMUSP00000097663
Gene: ENSMUSG00000026834
AA Change: I261T

DomainStartEndE-ValueType
Pfam:Activin_recp 1 50 1.1e-7 PFAM
Pfam:TGF_beta_GS 51 63 2.6e-7 PFAM
Pfam:Pkinase 65 352 5.6e-51 PFAM
Pfam:Pkinase_Tyr 65 352 4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112607
AA Change: I234T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108226
Gene: ENSMUSG00000026834
AA Change: I234T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 3.5e-15 PFAM
Pfam:Pkinase 51 325 9.5e-37 PFAM
Pfam:Pkinase_Tyr 92 325 4.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112608
AA Change: I311T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108227
Gene: ENSMUSG00000026834
AA Change: I311T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 4.9e-15 PFAM
Pfam:TGF_beta_GS 101 113 1.2e-8 PFAM
Pfam:Pkinase 115 402 2.3e-51 PFAM
Pfam:Pkinase_Tyr 115 402 1.6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131189
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ACVR1C is a type I receptor for the TGFB (see MIM 190180) family of signaling molecules. Upon ligand binding, type I receptors phosphorylate cytoplasmic SMAD transcription factors, which then translocate to the nucleus and interact directly with DNA or in complex with other transcription factors (Bondestam et al., 2001 [PubMed 12063393]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and overtly normal with no apparent left-right patterning abnormalities or organogenesis defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,679,511 E6G probably damaging Het
Amz1 A G 5: 140,744,164 D151G probably benign Het
Arhgap24 T C 5: 102,841,335 L10P probably damaging Het
Arhgap25 T G 6: 87,532,864 N8T probably benign Het
Arsi T G 18: 60,917,439 F465V probably damaging Het
Atp2c1 A G 9: 105,448,825 V293A probably damaging Het
Bzw2 A G 12: 36,104,351 L340P probably damaging Het
Camkmt C T 17: 85,096,581 T77I probably benign Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Cd163 T C 6: 124,317,989 C671R probably damaging Het
Cdk7 T C 13: 100,717,684 probably null Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Chn2 C T 6: 54,218,561 L72F possibly damaging Het
Cntn2 C A 1: 132,517,060 E363* probably null Het
Crebbp T C 16: 4,093,511 E999G probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Cts3 A C 13: 61,567,595 I141M probably benign Het
Cwc27 A T 13: 104,804,353 V166D probably damaging Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Dnah8 A G 17: 30,810,353 T4099A probably benign Het
Eml6 A G 11: 29,744,606 F1953L probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
Fbln1 A G 15: 85,237,671 E331G probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gcat T C 15: 79,035,282 V149A probably damaging Het
Glp2r A T 11: 67,722,100 probably null Het
Gm572 T C 4: 148,666,845 probably null Het
Golgb1 T C 16: 36,919,258 V2653A probably damaging Het
Grap2 G A 15: 80,646,144 R155Q possibly damaging Het
Gspt1 T A 16: 11,223,301 I533L probably damaging Het
Gypa A T 8: 80,496,348 Y27F unknown Het
Hipk4 G A 7: 27,529,492 V456I probably benign Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Hspa1b A T 17: 34,958,004 V335E possibly damaging Het
Ift122 A G 6: 115,912,534 T827A probably benign Het
Igkv1-35 T C 6: 70,011,135 N58S probably benign Het
Kat6b A T 14: 21,619,258 H297L probably damaging Het
Kirrel3 G T 9: 35,013,305 G296W probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Lrrn1 G T 6: 107,569,207 R655S possibly damaging Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Mill2 G A 7: 18,856,666 G209S probably benign Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mphosph10 A G 7: 64,389,596 S209P probably damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Myb T A 10: 21,126,238 M616L probably benign Het
Myo15b C T 11: 115,886,054 R867W probably damaging Het
Myo18b A T 5: 112,874,480 probably benign Het
Nip7 A G 8: 107,056,957 E8G possibly damaging Het
Olfr1318 A T 2: 112,156,286 M112L possibly damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr38 T A 6: 42,762,997 L315* probably null Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr711 T C 7: 106,972,231 I38V probably benign Het
Optn T A 2: 5,046,106 I155F probably benign Het
Papolb A T 5: 142,528,837 H350Q probably benign Het
Pappa2 T A 1: 158,838,627 M1128L probably benign Het
Pcdhb5 T A 18: 37,321,117 N183K probably benign Het
Pde12 G T 14: 26,669,422 S44* probably null Het
Peg3 T C 7: 6,710,289 K645E probably benign Het
Pkd1 C T 17: 24,573,463 R1375C probably benign Het
Plekha5 G A 6: 140,579,474 E21K probably damaging Het
Plk2 C T 13: 110,399,424 P554L probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polg A T 7: 79,464,605 W203R probably damaging Het
Ppcdc A G 9: 57,421,163 V65A possibly damaging Het
Ppm1m T A 9: 106,195,805 Q353L probably benign Het
Ppp1r13l G C 7: 19,370,095 R167P probably damaging Het
Ppp1r9b T A 11: 94,996,653 V497E probably damaging Het
Prpf6 T A 2: 181,636,043 H399Q probably benign Het
Psg25 T A 7: 18,526,536 I146F possibly damaging Het
Rasgef1c A T 11: 49,960,429 Q116L probably damaging Het
Rbbp9 A G 2: 144,550,756 V8A possibly damaging Het
Rfk T C 19: 17,399,566 F144S probably damaging Het
Rfwd3 A C 8: 111,282,753 probably null Het
Rhpn1 T C 15: 75,709,260 I117T probably damaging Het
Sars2 A T 7: 28,747,908 N244Y probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sgcz G A 8: 37,539,667 T195I probably damaging Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Spen T A 4: 141,476,099 Q1739L probably benign Het
Susd1 G T 4: 59,379,657 S323R possibly damaging Het
Szt2 T C 4: 118,385,444 E1482G possibly damaging Het
Tex15 A T 8: 33,571,766 K408I probably damaging Het
Tex33 C T 15: 78,386,173 E132K probably benign Het
Trem1 T A 17: 48,232,836 F14L probably null Het
Trim26 G T 17: 36,851,066 E126* probably null Het
Trpv3 T C 11: 73,277,834 probably null Het
Ttn T A 2: 76,916,491 probably null Het
Ubap1 C T 4: 41,379,688 L301F probably benign Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Vill C T 9: 119,070,025 T253I possibly damaging Het
Vmn2r107 C T 17: 20,355,753 T115I probably benign Het
Vmn2r98 T C 17: 19,053,553 S21P probably benign Het
Wapl A G 14: 34,677,162 K63E probably benign Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Zfp592 T C 7: 81,023,561 L91P probably damaging Het
Zfp74 T C 7: 29,932,507 probably null Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zranb1 A G 7: 132,950,187 E215G probably benign Het
Other mutations in Acvr1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Acvr1c APN 2 58315855 missense probably damaging 1.00
IGL00543:Acvr1c APN 2 58315823 missense probably damaging 1.00
IGL01287:Acvr1c APN 2 58280242 nonsense probably null
IGL01313:Acvr1c APN 2 58315974 missense probably benign 0.10
IGL01722:Acvr1c APN 2 58283549 splice site probably benign
R0035:Acvr1c UTSW 2 58315779 splice site probably benign
R0035:Acvr1c UTSW 2 58315779 splice site probably benign
R0329:Acvr1c UTSW 2 58284838 missense probably damaging 0.96
R0330:Acvr1c UTSW 2 58284838 missense probably damaging 0.96
R1311:Acvr1c UTSW 2 58280249 missense probably benign 0.04
R1465:Acvr1c UTSW 2 58284961 missense probably damaging 1.00
R1465:Acvr1c UTSW 2 58284961 missense probably damaging 1.00
R1511:Acvr1c UTSW 2 58287884 missense probably damaging 1.00
R1813:Acvr1c UTSW 2 58280294 missense probably damaging 1.00
R1896:Acvr1c UTSW 2 58280294 missense probably damaging 1.00
R1935:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R1939:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R1940:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R2001:Acvr1c UTSW 2 58315975 missense probably benign 0.04
R2002:Acvr1c UTSW 2 58315975 missense probably benign 0.04
R2305:Acvr1c UTSW 2 58281699 missense probably damaging 1.00
R4786:Acvr1c UTSW 2 58280354 missense probably damaging 1.00
R4947:Acvr1c UTSW 2 58315975 missense probably benign 0.04
R5133:Acvr1c UTSW 2 58283506 missense probably damaging 1.00
R5381:Acvr1c UTSW 2 58287735 missense probably damaging 1.00
R5383:Acvr1c UTSW 2 58287735 missense probably damaging 1.00
R5647:Acvr1c UTSW 2 58295964 missense probably damaging 1.00
R5988:Acvr1c UTSW 2 58315874 missense probably damaging 1.00
R6860:Acvr1c UTSW 2 58287705 missense probably damaging 1.00
R7137:Acvr1c UTSW 2 58283387 critical splice donor site probably null
R7200:Acvr1c UTSW 2 58315855 missense probably damaging 1.00
R7278:Acvr1c UTSW 2 58284936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTCCTCTTTTGCCTCTGTAAAG -3'
(R):5'- AATGATGGCTGTGTCAATACTGTG -3'

Sequencing Primer
(F):5'- GCCTCTGTAAAGAAATCACTGAATGG -3'
(R):5'- ATTCCACCCTATTATGGTATCTGAG -3'
Posted On2016-06-15