Incidental Mutation 'R5121:Myo18b'
ID393003
Institutional Source Beutler Lab
Gene Symbol Myo18b
Ensembl Gene ENSMUSG00000072720
Gene Namemyosin XVIIIb
Synonyms4932408L24Rik, 4933411E19Rik
MMRRC Submission 042709-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5121 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location112688876-112896362 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 112874480 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000086617]
Predicted Effect unknown
Transcript: ENSMUST00000086617
AA Change: C349S
SMART Domains Protein: ENSMUSP00000083810
Gene: ENSMUSG00000072720
AA Change: C349S

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
low complexity region 377 419 N/A INTRINSIC
MYSc 605 1374 8.78e-30 SMART
IQ 1375 1397 5.92e-4 SMART
Pfam:Myosin_tail_1 1423 1875 5e-12 PFAM
low complexity region 1965 1985 N/A INTRINSIC
coiled coil region 2052 2126 N/A INTRINSIC
low complexity region 2184 2199 N/A INTRINSIC
low complexity region 2325 2336 N/A INTRINSIC
low complexity region 2408 2424 N/A INTRINSIC
low complexity region 2544 2558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183029
Predicted Effect probably benign
Transcript: ENSMUST00000183273
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may regulate muscle-specific genes when in the nucleus and may influence intracellular trafficking when in the cytoplasm. The encoded protein functions as a homodimer and may interact with F actin. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with internal hemorrhage, pericaridal effusion, enlargement of the right atrium, and cardiac myofibril abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,281,650 I234T probably damaging Het
Adam24 A G 8: 40,679,511 E6G probably damaging Het
Amz1 A G 5: 140,744,164 D151G probably benign Het
Arhgap24 T C 5: 102,841,335 L10P probably damaging Het
Arhgap25 T G 6: 87,532,864 N8T probably benign Het
Arsi T G 18: 60,917,439 F465V probably damaging Het
Atp2c1 A G 9: 105,448,825 V293A probably damaging Het
Bzw2 A G 12: 36,104,351 L340P probably damaging Het
Camkmt C T 17: 85,096,581 T77I probably benign Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Cd163 T C 6: 124,317,989 C671R probably damaging Het
Cdk7 T C 13: 100,717,684 probably null Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Chn2 C T 6: 54,218,561 L72F possibly damaging Het
Cntn2 C A 1: 132,517,060 E363* probably null Het
Crebbp T C 16: 4,093,511 E999G probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Cts3 A C 13: 61,567,595 I141M probably benign Het
Cwc27 A T 13: 104,804,353 V166D probably damaging Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Dnah8 A G 17: 30,810,353 T4099A probably benign Het
Eml6 A G 11: 29,744,606 F1953L probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
Fbln1 A G 15: 85,237,671 E331G probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gcat T C 15: 79,035,282 V149A probably damaging Het
Glp2r A T 11: 67,722,100 probably null Het
Gm572 T C 4: 148,666,845 probably null Het
Golgb1 T C 16: 36,919,258 V2653A probably damaging Het
Grap2 G A 15: 80,646,144 R155Q possibly damaging Het
Gspt1 T A 16: 11,223,301 I533L probably damaging Het
Gypa A T 8: 80,496,348 Y27F unknown Het
Hipk4 G A 7: 27,529,492 V456I probably benign Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Hspa1b A T 17: 34,958,004 V335E possibly damaging Het
Ift122 A G 6: 115,912,534 T827A probably benign Het
Igkv1-35 T C 6: 70,011,135 N58S probably benign Het
Kat6b A T 14: 21,619,258 H297L probably damaging Het
Kirrel3 G T 9: 35,013,305 G296W probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Lrrn1 G T 6: 107,569,207 R655S possibly damaging Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Mill2 G A 7: 18,856,666 G209S probably benign Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mphosph10 A G 7: 64,389,596 S209P probably damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Myb T A 10: 21,126,238 M616L probably benign Het
Myo15b C T 11: 115,886,054 R867W probably damaging Het
Nip7 A G 8: 107,056,957 E8G possibly damaging Het
Olfr1318 A T 2: 112,156,286 M112L possibly damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr38 T A 6: 42,762,997 L315* probably null Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr711 T C 7: 106,972,231 I38V probably benign Het
Optn T A 2: 5,046,106 I155F probably benign Het
Papolb A T 5: 142,528,837 H350Q probably benign Het
Pappa2 T A 1: 158,838,627 M1128L probably benign Het
Pcdhb5 T A 18: 37,321,117 N183K probably benign Het
Pde12 G T 14: 26,669,422 S44* probably null Het
Peg3 T C 7: 6,710,289 K645E probably benign Het
Pkd1 C T 17: 24,573,463 R1375C probably benign Het
Plekha5 G A 6: 140,579,474 E21K probably damaging Het
Plk2 C T 13: 110,399,424 P554L probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polg A T 7: 79,464,605 W203R probably damaging Het
Ppcdc A G 9: 57,421,163 V65A possibly damaging Het
Ppm1m T A 9: 106,195,805 Q353L probably benign Het
Ppp1r13l G C 7: 19,370,095 R167P probably damaging Het
Ppp1r9b T A 11: 94,996,653 V497E probably damaging Het
Prpf6 T A 2: 181,636,043 H399Q probably benign Het
Psg25 T A 7: 18,526,536 I146F possibly damaging Het
Rasgef1c A T 11: 49,960,429 Q116L probably damaging Het
Rbbp9 A G 2: 144,550,756 V8A possibly damaging Het
Rfk T C 19: 17,399,566 F144S probably damaging Het
Rfwd3 A C 8: 111,282,753 probably null Het
Rhpn1 T C 15: 75,709,260 I117T probably damaging Het
Sars2 A T 7: 28,747,908 N244Y probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sgcz G A 8: 37,539,667 T195I probably damaging Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Spen T A 4: 141,476,099 Q1739L probably benign Het
Susd1 G T 4: 59,379,657 S323R possibly damaging Het
Szt2 T C 4: 118,385,444 E1482G possibly damaging Het
Tex15 A T 8: 33,571,766 K408I probably damaging Het
Tex33 C T 15: 78,386,173 E132K probably benign Het
Trem1 T A 17: 48,232,836 F14L probably null Het
Trim26 G T 17: 36,851,066 E126* probably null Het
Trpv3 T C 11: 73,277,834 probably null Het
Ttn T A 2: 76,916,491 probably null Het
Ubap1 C T 4: 41,379,688 L301F probably benign Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Vill C T 9: 119,070,025 T253I possibly damaging Het
Vmn2r107 C T 17: 20,355,753 T115I probably benign Het
Vmn2r98 T C 17: 19,053,553 S21P probably benign Het
Wapl A G 14: 34,677,162 K63E probably benign Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Zfp592 T C 7: 81,023,561 L91P probably damaging Het
Zfp74 T C 7: 29,932,507 probably null Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zranb1 A G 7: 132,950,187 E215G probably benign Het
Other mutations in Myo18b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Myo18b APN 5 112874131 missense probably benign 0.05
IGL00847:Myo18b APN 5 112830389 splice site probably benign
IGL00848:Myo18b APN 5 112871485 missense probably damaging 1.00
IGL00969:Myo18b APN 5 112875007 unclassified probably benign
IGL01018:Myo18b APN 5 112809747 missense probably damaging 1.00
IGL01448:Myo18b APN 5 112811704 missense probably damaging 1.00
IGL01490:Myo18b APN 5 112809700 missense possibly damaging 0.84
IGL01556:Myo18b APN 5 112757449 splice site probably benign
IGL01637:Myo18b APN 5 112840629 missense possibly damaging 0.82
IGL01819:Myo18b APN 5 112878050 missense unknown
IGL02007:Myo18b APN 5 112874972 unclassified probably benign
IGL02146:Myo18b APN 5 112843285 missense probably damaging 1.00
IGL02229:Myo18b APN 5 112878110 missense unknown
IGL02319:Myo18b APN 5 112791139 missense probably damaging 0.99
IGL02398:Myo18b APN 5 112830312 missense possibly damaging 0.92
IGL02420:Myo18b APN 5 112827986 missense possibly damaging 0.64
IGL02626:Myo18b APN 5 112878085 missense unknown
IGL02815:Myo18b APN 5 112809735 missense probably damaging 1.00
IGL02822:Myo18b APN 5 112775345 missense probably damaging 1.00
IGL02852:Myo18b APN 5 112715511 missense probably benign 0.03
IGL02995:Myo18b APN 5 112775413 splice site probably benign
IGL03019:Myo18b APN 5 112692397 missense probably benign 0.21
IGL03039:Myo18b APN 5 112840771 missense probably damaging 1.00
IGL03112:Myo18b APN 5 112873990 missense probably benign 0.02
IGL03123:Myo18b APN 5 112874938 unclassified probably benign
IGL03288:Myo18b APN 5 112789997 missense probably damaging 1.00
IGL03391:Myo18b APN 5 112874479 unclassified probably benign
PIT4651001:Myo18b UTSW 5 112834435 missense probably benign 0.01
R0271:Myo18b UTSW 5 112809685 missense possibly damaging 0.91
R0277:Myo18b UTSW 5 112693347 splice site probably benign
R0352:Myo18b UTSW 5 112874523 unclassified probably benign
R0504:Myo18b UTSW 5 112873576 unclassified probably benign
R0539:Myo18b UTSW 5 112723868 missense probably damaging 0.99
R0599:Myo18b UTSW 5 112865750 missense probably damaging 1.00
R0627:Myo18b UTSW 5 112798834 missense probably benign 0.38
R0659:Myo18b UTSW 5 112760327 missense possibly damaging 0.66
R0671:Myo18b UTSW 5 112692766 missense probably benign 0.00
R0847:Myo18b UTSW 5 112874488 unclassified probably benign
R1082:Myo18b UTSW 5 112760414 missense probably damaging 1.00
R1116:Myo18b UTSW 5 112803279 missense probably damaging 1.00
R1264:Myo18b UTSW 5 112830319 missense probably benign 0.12
R1280:Myo18b UTSW 5 112723805 critical splice donor site probably null
R1444:Myo18b UTSW 5 112775251 critical splice donor site probably null
R1446:Myo18b UTSW 5 112757559 missense probably damaging 1.00
R1470:Myo18b UTSW 5 112693033 missense probably damaging 1.00
R1470:Myo18b UTSW 5 112693033 missense probably damaging 1.00
R1590:Myo18b UTSW 5 112875266 nonsense probably null
R1601:Myo18b UTSW 5 112871498 missense possibly damaging 0.73
R1903:Myo18b UTSW 5 112692758 missense probably damaging 1.00
R1935:Myo18b UTSW 5 112760356 missense probably benign 0.04
R1936:Myo18b UTSW 5 112760356 missense probably benign 0.04
R2008:Myo18b UTSW 5 112873557 missense probably benign
R2127:Myo18b UTSW 5 112831078 missense probably damaging 1.00
R2129:Myo18b UTSW 5 112831078 missense probably damaging 1.00
R2141:Myo18b UTSW 5 112874026 missense probably benign 0.01
R2170:Myo18b UTSW 5 112723858 missense probably benign 0.23
R2258:Myo18b UTSW 5 112874663 unclassified probably benign
R2265:Myo18b UTSW 5 112782673 missense probably damaging 1.00
R2483:Myo18b UTSW 5 112858408 missense probably damaging 1.00
R2931:Myo18b UTSW 5 112693127 missense probably benign 0.01
R3160:Myo18b UTSW 5 112692728 missense probably damaging 0.99
R3162:Myo18b UTSW 5 112692728 missense probably damaging 0.99
R3777:Myo18b UTSW 5 112757596 missense probably damaging 0.99
R4240:Myo18b UTSW 5 112803187 critical splice donor site probably null
R4243:Myo18b UTSW 5 112692395 missense possibly damaging 0.95
R4245:Myo18b UTSW 5 112692395 missense possibly damaging 0.95
R4533:Myo18b UTSW 5 112693025 missense probably damaging 1.00
R4631:Myo18b UTSW 5 112846400 missense probably damaging 1.00
R4661:Myo18b UTSW 5 112875175 unclassified probably benign
R4755:Myo18b UTSW 5 112874474 nonsense probably null
R4771:Myo18b UTSW 5 112692227 nonsense probably null
R4812:Myo18b UTSW 5 112809718 missense possibly damaging 0.95
R4840:Myo18b UTSW 5 112874029 missense probably benign 0.02
R4888:Myo18b UTSW 5 112874480 unclassified probably benign
R4995:Myo18b UTSW 5 112760392 missense probably damaging 0.99
R5001:Myo18b UTSW 5 112761340 missense probably damaging 0.99
R5015:Myo18b UTSW 5 112790057 missense probably damaging 1.00
R5055:Myo18b UTSW 5 112875217 unclassified probably benign
R5070:Myo18b UTSW 5 112761346 missense probably damaging 1.00
R5105:Myo18b UTSW 5 112840778 missense probably damaging 1.00
R5130:Myo18b UTSW 5 112873903 missense probably benign 0.06
R5186:Myo18b UTSW 5 112871470 missense probably damaging 1.00
R5437:Myo18b UTSW 5 112757573 missense possibly damaging 0.73
R5535:Myo18b UTSW 5 112790042 missense probably damaging 1.00
R5560:Myo18b UTSW 5 112868295 missense probably damaging 0.96
R5810:Myo18b UTSW 5 112834450 missense probably damaging 1.00
R5898:Myo18b UTSW 5 112802330 intron probably null
R6065:Myo18b UTSW 5 112692781 missense probably benign 0.00
R6104:Myo18b UTSW 5 112874291 unclassified probably benign
R6113:Myo18b UTSW 5 112866385 missense probably damaging 1.00
R6158:Myo18b UTSW 5 112874172 missense probably benign 0.01
R6167:Myo18b UTSW 5 112872507 splice site probably null
R6220:Myo18b UTSW 5 112757507 missense possibly damaging 0.93
R6276:Myo18b UTSW 5 112811642 missense probably benign 0.31
R6290:Myo18b UTSW 5 112865735 missense possibly damaging 0.69
R6291:Myo18b UTSW 5 112865735 missense possibly damaging 0.69
R6795:Myo18b UTSW 5 112846364 missense probably damaging 0.99
R6798:Myo18b UTSW 5 112761386 missense probably damaging 0.98
R6817:Myo18b UTSW 5 112830238 missense probably benign 0.00
R6937:Myo18b UTSW 5 112802392 missense probably benign 0.12
R7034:Myo18b UTSW 5 112723904 nonsense probably null
R7097:Myo18b UTSW 5 112874405 missense unknown
R7145:Myo18b UTSW 5 112817679 nonsense probably null
R7201:Myo18b UTSW 5 112715459 missense probably damaging 1.00
R7260:Myo18b UTSW 5 112775288 missense probably benign 0.01
R7265:Myo18b UTSW 5 112812072 missense probably damaging 1.00
Z1088:Myo18b UTSW 5 112692943 missense possibly damaging 0.89
Z1088:Myo18b UTSW 5 112757484 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ATCTTCACTGGAGCCTCCTG -3'
(R):5'- TGAGTCTCAGAGCACAGAGG -3'

Sequencing Primer
(F):5'- TGCTGGCTGTCCCGTGG -3'
(R):5'- TGAGCCCAAGGTTGCAGG -3'
Posted On2016-06-15