Incidental Mutation 'R5121:Pnkp'
ID393023
Institutional Source Beutler Lab
Gene Symbol Pnkp
Ensembl Gene ENSMUSG00000002963
Gene Namepolynucleotide kinase 3'- phosphatase
SynonymsPNK, 1810009G08Rik
MMRRC Submission 042709-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R5121 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44857139-44862992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44862403 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 113 (S113L)
Ref Sequence ENSEMBL: ENSMUSP00000144484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003044] [ENSMUST00000046575] [ENSMUST00000098478] [ENSMUST00000107876] [ENSMUST00000123015] [ENSMUST00000124168] [ENSMUST00000139003] [ENSMUST00000154968] [ENSMUST00000155050] [ENSMUST00000200892] [ENSMUST00000201882] [ENSMUST00000202646] [ENSMUST00000207363] [ENSMUST00000209018]
Predicted Effect probably damaging
Transcript: ENSMUST00000003044
AA Change: S474L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003044
Gene: ENSMUSG00000002963
AA Change: S474L

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 4e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 9.3e-58 PFAM
low complexity region 350 364 N/A INTRINSIC
Pfam:AAA_33 366 488 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046575
SMART Domains Protein: ENSMUSP00000035281
Gene: ENSMUSG00000038502

DomainStartEndE-ValueType
low complexity region 10 50 N/A INTRINSIC
low complexity region 64 82 N/A INTRINSIC
Pfam:Med25 89 238 1.7e-58 PFAM
Pfam:Med25 254 399 4.2e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098478
AA Change: S438L

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096078
Gene: ENSMUSG00000002963
AA Change: S438L

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 2e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 220 2.9e-16 PFAM
Pfam:PNK3P 211 291 5.3e-27 PFAM
low complexity region 314 328 N/A INTRINSIC
Pfam:AAA_33 330 452 5.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107876
AA Change: S474L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103508
Gene: ENSMUSG00000002963
AA Change: S474L

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 4e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 1.9e-57 PFAM
low complexity region 350 364 N/A INTRINSIC
Pfam:AAA_33 366 488 5.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123015
SMART Domains Protein: ENSMUSP00000143862
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJ5|C 1 143 8e-72 PDB
SCOP:d1lgpa_ 8 114 7e-13 SMART
Blast:FHA 31 74 2e-10 BLAST
PDB:3U7G|A 144 165 7e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000124168
SMART Domains Protein: ENSMUSP00000144330
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 51 3e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126860
Predicted Effect probably benign
Transcript: ENSMUST00000139003
SMART Domains Protein: ENSMUSP00000143904
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 51 3e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152747
Predicted Effect probably benign
Transcript: ENSMUST00000154968
Predicted Effect probably benign
Transcript: ENSMUST00000155050
SMART Domains Protein: ENSMUSP00000144663
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 50 9e-30 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000200892
AA Change: S95L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144163
Gene: ENSMUSG00000002963
AA Change: S95L

DomainStartEndE-ValueType
Pfam:AAA_33 18 100 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201882
SMART Domains Protein: ENSMUSP00000144690
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 6e-63 PDB
SCOP:d1lgpa_ 8 114 3e-12 SMART
Blast:FHA 31 74 2e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 9.9e-55 PFAM
low complexity region 350 364 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202646
AA Change: S113L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144484
Gene: ENSMUSG00000002963
AA Change: S113L

DomainStartEndE-ValueType
Pfam:AAA_33 5 44 6.1e-7 PFAM
Pfam:AAA_33 37 117 4.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207303
Predicted Effect probably benign
Transcript: ENSMUST00000207363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207393
Predicted Effect probably benign
Transcript: ENSMUST00000207416
Predicted Effect probably benign
Transcript: ENSMUST00000208385
Predicted Effect probably benign
Transcript: ENSMUST00000208410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208655
Predicted Effect probably benign
Transcript: ENSMUST00000208666
Predicted Effect probably benign
Transcript: ENSMUST00000208682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209003
Predicted Effect probably benign
Transcript: ENSMUST00000209018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209139
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus represents a gene involved in DNA repair. In response to ionizing radiation or oxidative damage, the protein encoded by this locus catalyzes 5' phosphorylation and 3' dephosphorylation of nucleic acids. Mutations at this locus have been associated with microcephaly, seizures, and developmental delay.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a frame-shift allele are embryonic lethal. Homozygotes for a hypomorphic allele exhibit smaller brain (cortex and cerebellum) and defects in both single- and double-strand DNA break repair associated with increased brain apoptosis and decreased proliferation in cortical progenitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,281,650 I234T probably damaging Het
Adam24 A G 8: 40,679,511 E6G probably damaging Het
Amz1 A G 5: 140,744,164 D151G probably benign Het
Arhgap24 T C 5: 102,841,335 L10P probably damaging Het
Arhgap25 T G 6: 87,532,864 N8T probably benign Het
Arsi T G 18: 60,917,439 F465V probably damaging Het
Atp2c1 A G 9: 105,448,825 V293A probably damaging Het
Bzw2 A G 12: 36,104,351 L340P probably damaging Het
Camkmt C T 17: 85,096,581 T77I probably benign Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Cd163 T C 6: 124,317,989 C671R probably damaging Het
Cdk7 T C 13: 100,717,684 probably null Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Chn2 C T 6: 54,218,561 L72F possibly damaging Het
Cntn2 C A 1: 132,517,060 E363* probably null Het
Crebbp T C 16: 4,093,511 E999G probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Cts3 A C 13: 61,567,595 I141M probably benign Het
Cwc27 A T 13: 104,804,353 V166D probably damaging Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Dnah8 A G 17: 30,810,353 T4099A probably benign Het
Eml6 A G 11: 29,744,606 F1953L probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
Fbln1 A G 15: 85,237,671 E331G probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gcat T C 15: 79,035,282 V149A probably damaging Het
Glp2r A T 11: 67,722,100 probably null Het
Gm572 T C 4: 148,666,845 probably null Het
Golgb1 T C 16: 36,919,258 V2653A probably damaging Het
Grap2 G A 15: 80,646,144 R155Q possibly damaging Het
Gspt1 T A 16: 11,223,301 I533L probably damaging Het
Gypa A T 8: 80,496,348 Y27F unknown Het
Hipk4 G A 7: 27,529,492 V456I probably benign Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Hspa1b A T 17: 34,958,004 V335E possibly damaging Het
Ift122 A G 6: 115,912,534 T827A probably benign Het
Igkv1-35 T C 6: 70,011,135 N58S probably benign Het
Kat6b A T 14: 21,619,258 H297L probably damaging Het
Kirrel3 G T 9: 35,013,305 G296W probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Lrrn1 G T 6: 107,569,207 R655S possibly damaging Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Mill2 G A 7: 18,856,666 G209S probably benign Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mphosph10 A G 7: 64,389,596 S209P probably damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Myb T A 10: 21,126,238 M616L probably benign Het
Myo15b C T 11: 115,886,054 R867W probably damaging Het
Myo18b A T 5: 112,874,480 probably benign Het
Nip7 A G 8: 107,056,957 E8G possibly damaging Het
Olfr1318 A T 2: 112,156,286 M112L possibly damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr38 T A 6: 42,762,997 L315* probably null Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr711 T C 7: 106,972,231 I38V probably benign Het
Optn T A 2: 5,046,106 I155F probably benign Het
Papolb A T 5: 142,528,837 H350Q probably benign Het
Pappa2 T A 1: 158,838,627 M1128L probably benign Het
Pcdhb5 T A 18: 37,321,117 N183K probably benign Het
Pde12 G T 14: 26,669,422 S44* probably null Het
Peg3 T C 7: 6,710,289 K645E probably benign Het
Pkd1 C T 17: 24,573,463 R1375C probably benign Het
Plekha5 G A 6: 140,579,474 E21K probably damaging Het
Plk2 C T 13: 110,399,424 P554L probably benign Het
Polg A T 7: 79,464,605 W203R probably damaging Het
Ppcdc A G 9: 57,421,163 V65A possibly damaging Het
Ppm1m T A 9: 106,195,805 Q353L probably benign Het
Ppp1r13l G C 7: 19,370,095 R167P probably damaging Het
Ppp1r9b T A 11: 94,996,653 V497E probably damaging Het
Prpf6 T A 2: 181,636,043 H399Q probably benign Het
Psg25 T A 7: 18,526,536 I146F possibly damaging Het
Rasgef1c A T 11: 49,960,429 Q116L probably damaging Het
Rbbp9 A G 2: 144,550,756 V8A possibly damaging Het
Rfk T C 19: 17,399,566 F144S probably damaging Het
Rfwd3 A C 8: 111,282,753 probably null Het
Rhpn1 T C 15: 75,709,260 I117T probably damaging Het
Sars2 A T 7: 28,747,908 N244Y probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sgcz G A 8: 37,539,667 T195I probably damaging Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Spen T A 4: 141,476,099 Q1739L probably benign Het
Susd1 G T 4: 59,379,657 S323R possibly damaging Het
Szt2 T C 4: 118,385,444 E1482G possibly damaging Het
Tex15 A T 8: 33,571,766 K408I probably damaging Het
Tex33 C T 15: 78,386,173 E132K probably benign Het
Trem1 T A 17: 48,232,836 F14L probably null Het
Trim26 G T 17: 36,851,066 E126* probably null Het
Trpv3 T C 11: 73,277,834 probably null Het
Ttn T A 2: 76,916,491 probably null Het
Ubap1 C T 4: 41,379,688 L301F probably benign Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Vill C T 9: 119,070,025 T253I possibly damaging Het
Vmn2r107 C T 17: 20,355,753 T115I probably benign Het
Vmn2r98 T C 17: 19,053,553 S21P probably benign Het
Wapl A G 14: 34,677,162 K63E probably benign Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Zfp592 T C 7: 81,023,561 L91P probably damaging Het
Zfp74 T C 7: 29,932,507 probably null Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zranb1 A G 7: 132,950,187 E215G probably benign Het
Other mutations in Pnkp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Pnkp APN 7 44862207 missense probably damaging 1.00
IGL02750:Pnkp APN 7 44860187 unclassified probably benign
IGL02822:Pnkp APN 7 44862424 missense probably damaging 1.00
R1168:Pnkp UTSW 7 44862537 missense probably benign 0.00
R1437:Pnkp UTSW 7 44860402 missense possibly damaging 0.87
R1953:Pnkp UTSW 7 44862602 missense probably benign 0.02
R2879:Pnkp UTSW 7 44858678 missense probably damaging 0.99
R4329:Pnkp UTSW 7 44858594 missense probably benign 0.02
R4732:Pnkp UTSW 7 44860454 unclassified probably benign
R4842:Pnkp UTSW 7 44861646 splice site probably null
R4846:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4861:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4861:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4872:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4873:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4875:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5068:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5120:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5266:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5267:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R6532:Pnkp UTSW 7 44857405 start codon destroyed probably null 0.99
R6974:Pnkp UTSW 7 44861038 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGCTGTTTTGCCTCCAC -3'
(R):5'- CTCCTGTAACCGGAATGGAATC -3'

Sequencing Primer
(F):5'- GTACATCCAATGTGCCAAAGATG -3'
(R):5'- TCCTGTAACCGGAATGGAATCTCAAG -3'
Posted On2016-06-15