Incidental Mutation 'R5121:Myb'
ID393046
Institutional Source Beutler Lab
Gene Symbol Myb
Ensembl Gene ENSMUSG00000019982
Gene Namemyeloblastosis oncogene
Synonymsc-myb
MMRRC Submission 042709-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5121 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location21124935-21160984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21126238 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 616 (M616L)
Ref Sequence ENSEMBL: ENSMUSP00000020158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020158] [ENSMUST00000188495]
PDB Structure
CRYSTAL STRUCTURE OF C-MYB R1 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF C-MYB R2R3 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF C-MYB R2 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF C-MYB R2 V103L MUTANT [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF TERNARY PROTEIN-DNA COMPLEX1 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF TERNARY PROTEIN-DNA COMPLEX2 [X-RAY DIFFRACTION]
STRUCTURE OF MYB TRANSFORMING PROTEIN, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
STRUCTURE OF MYB TRANSFORMING PROTEIN, NMR, 20 STRUCTURES [SOLUTION NMR]
MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 1 [SOLUTION NMR]
MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 1 [SOLUTION NMR]
>> 8 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000020158
AA Change: M616L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000020158
Gene: ENSMUSG00000019982
AA Change: M616L

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
SANT 39 88 9.52e-20 SMART
SANT 91 140 2.04e-19 SMART
SANT 143 191 1.75e-18 SMART
low complexity region 227 239 N/A INTRINSIC
Pfam:LMSTEN 267 313 4e-29 PFAM
Pfam:Cmyb_C 399 559 1.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188495
AA Change: M735L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139699
Gene: ENSMUSG00000019982
AA Change: M735L

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
SANT 39 88 9.52e-20 SMART
SANT 91 140 2.04e-19 SMART
SANT 143 191 1.75e-18 SMART
low complexity region 227 239 N/A INTRINSIC
Pfam:LMSTEN 266 313 3.6e-32 PFAM
low complexity region 409 421 N/A INTRINSIC
Pfam:Cmyb_C 516 682 8.5e-66 PFAM
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with three HTH DNA-binding domains that functions as a transcription regulator. This protein plays an essential role in the regulation of hematopoiesis. This gene may be aberrently expressed or rearranged or undergo translocation in leukemias and lymphomas, and is considered to be an oncogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for deficient alleles of this gene display severe hematopoietic abnormalities. Red and white blood cells and platelets are all affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,281,650 I234T probably damaging Het
Adam24 A G 8: 40,679,511 E6G probably damaging Het
Amz1 A G 5: 140,744,164 D151G probably benign Het
Arhgap24 T C 5: 102,841,335 L10P probably damaging Het
Arhgap25 T G 6: 87,532,864 N8T probably benign Het
Arsi T G 18: 60,917,439 F465V probably damaging Het
Atp2c1 A G 9: 105,448,825 V293A probably damaging Het
Bzw2 A G 12: 36,104,351 L340P probably damaging Het
Camkmt C T 17: 85,096,581 T77I probably benign Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Cd163 T C 6: 124,317,989 C671R probably damaging Het
Cdk7 T C 13: 100,717,684 probably null Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Chn2 C T 6: 54,218,561 L72F possibly damaging Het
Cntn2 C A 1: 132,517,060 E363* probably null Het
Crebbp T C 16: 4,093,511 E999G probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Cts3 A C 13: 61,567,595 I141M probably benign Het
Cwc27 A T 13: 104,804,353 V166D probably damaging Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Dnah8 A G 17: 30,810,353 T4099A probably benign Het
Eml6 A G 11: 29,744,606 F1953L probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
Fbln1 A G 15: 85,237,671 E331G probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gcat T C 15: 79,035,282 V149A probably damaging Het
Glp2r A T 11: 67,722,100 probably null Het
Gm572 T C 4: 148,666,845 probably null Het
Golgb1 T C 16: 36,919,258 V2653A probably damaging Het
Grap2 G A 15: 80,646,144 R155Q possibly damaging Het
Gspt1 T A 16: 11,223,301 I533L probably damaging Het
Gypa A T 8: 80,496,348 Y27F unknown Het
Hipk4 G A 7: 27,529,492 V456I probably benign Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Hspa1b A T 17: 34,958,004 V335E possibly damaging Het
Ift122 A G 6: 115,912,534 T827A probably benign Het
Igkv1-35 T C 6: 70,011,135 N58S probably benign Het
Kat6b A T 14: 21,619,258 H297L probably damaging Het
Kirrel3 G T 9: 35,013,305 G296W probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Lrrn1 G T 6: 107,569,207 R655S possibly damaging Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Mill2 G A 7: 18,856,666 G209S probably benign Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mphosph10 A G 7: 64,389,596 S209P probably damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Myo15b C T 11: 115,886,054 R867W probably damaging Het
Myo18b A T 5: 112,874,480 probably benign Het
Nip7 A G 8: 107,056,957 E8G possibly damaging Het
Olfr1318 A T 2: 112,156,286 M112L possibly damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr38 T A 6: 42,762,997 L315* probably null Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr711 T C 7: 106,972,231 I38V probably benign Het
Optn T A 2: 5,046,106 I155F probably benign Het
Papolb A T 5: 142,528,837 H350Q probably benign Het
Pappa2 T A 1: 158,838,627 M1128L probably benign Het
Pcdhb5 T A 18: 37,321,117 N183K probably benign Het
Pde12 G T 14: 26,669,422 S44* probably null Het
Peg3 T C 7: 6,710,289 K645E probably benign Het
Pkd1 C T 17: 24,573,463 R1375C probably benign Het
Plekha5 G A 6: 140,579,474 E21K probably damaging Het
Plk2 C T 13: 110,399,424 P554L probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polg A T 7: 79,464,605 W203R probably damaging Het
Ppcdc A G 9: 57,421,163 V65A possibly damaging Het
Ppm1m T A 9: 106,195,805 Q353L probably benign Het
Ppp1r13l G C 7: 19,370,095 R167P probably damaging Het
Ppp1r9b T A 11: 94,996,653 V497E probably damaging Het
Prpf6 T A 2: 181,636,043 H399Q probably benign Het
Psg25 T A 7: 18,526,536 I146F possibly damaging Het
Rasgef1c A T 11: 49,960,429 Q116L probably damaging Het
Rbbp9 A G 2: 144,550,756 V8A possibly damaging Het
Rfk T C 19: 17,399,566 F144S probably damaging Het
Rfwd3 A C 8: 111,282,753 probably null Het
Rhpn1 T C 15: 75,709,260 I117T probably damaging Het
Sars2 A T 7: 28,747,908 N244Y probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sgcz G A 8: 37,539,667 T195I probably damaging Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Spen T A 4: 141,476,099 Q1739L probably benign Het
Susd1 G T 4: 59,379,657 S323R possibly damaging Het
Szt2 T C 4: 118,385,444 E1482G possibly damaging Het
Tex15 A T 8: 33,571,766 K408I probably damaging Het
Tex33 C T 15: 78,386,173 E132K probably benign Het
Trem1 T A 17: 48,232,836 F14L probably null Het
Trim26 G T 17: 36,851,066 E126* probably null Het
Trpv3 T C 11: 73,277,834 probably null Het
Ttn T A 2: 76,916,491 probably null Het
Ubap1 C T 4: 41,379,688 L301F probably benign Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Vill C T 9: 119,070,025 T253I possibly damaging Het
Vmn2r107 C T 17: 20,355,753 T115I probably benign Het
Vmn2r98 T C 17: 19,053,553 S21P probably benign Het
Wapl A G 14: 34,677,162 K63E probably benign Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Zfp592 T C 7: 81,023,561 L91P probably damaging Het
Zfp74 T C 7: 29,932,507 probably null Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zranb1 A G 7: 132,950,187 E215G probably benign Het
Other mutations in Myb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Myb APN 10 21141826 missense probably damaging 0.99
IGL00707:Myb APN 10 21148384 missense probably damaging 1.00
IGL00796:Myb APN 10 21141799 missense probably benign 0.00
IGL01012:Myb APN 10 21146260 missense probably benign 0.03
IGL01082:Myb APN 10 21152944 missense probably damaging 1.00
IGL01365:Myb APN 10 21152502 missense probably benign 0.31
IGL01906:Myb APN 10 21152634 missense probably damaging 1.00
IGL02560:Myb APN 10 21152448 missense probably damaging 1.00
Huang_river UTSW 10 21152617 missense probably damaging 1.00
PIT4495001:Myb UTSW 10 21152622 missense probably damaging 0.98
R0385:Myb UTSW 10 21154712 missense possibly damaging 0.73
R0442:Myb UTSW 10 21126196 missense probably benign 0.05
R0759:Myb UTSW 10 21145028 missense probably benign 0.01
R0882:Myb UTSW 10 21156360 missense possibly damaging 0.75
R0920:Myb UTSW 10 21126234 missense possibly damaging 0.80
R1401:Myb UTSW 10 21152945 missense probably damaging 1.00
R1651:Myb UTSW 10 21126198 missense probably damaging 1.00
R1752:Myb UTSW 10 21156437 missense possibly damaging 0.89
R1879:Myb UTSW 10 21141977 missense probably benign 0.24
R1971:Myb UTSW 10 21140656 missense probably benign 0.00
R4355:Myb UTSW 10 21152617 missense probably damaging 1.00
R4611:Myb UTSW 10 21145324 missense probably damaging 1.00
R4650:Myb UTSW 10 21152941 missense probably damaging 1.00
R4888:Myb UTSW 10 21126238 missense probably benign 0.01
R5922:Myb UTSW 10 21152927 missense probably damaging 1.00
R5955:Myb UTSW 10 21152499 missense probably damaging 1.00
R6116:Myb UTSW 10 21154754 missense probably damaging 1.00
R6150:Myb UTSW 10 21141769 missense probably damaging 1.00
R6207:Myb UTSW 10 21145322 missense probably benign
R6656:Myb UTSW 10 21152945 missense probably damaging 1.00
R6801:Myb UTSW 10 21144966 splice site probably null
R6824:Myb UTSW 10 21145120 missense probably benign 0.00
R6884:Myb UTSW 10 21152532 missense probably damaging 1.00
R6977:Myb UTSW 10 21152652 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAAATCAGGCTCTTCTCTCAGC -3'
(R):5'- TTGGAAAACTGCCTGCGAG -3'

Sequencing Primer
(F):5'- TTCTCTCAGCCATGGAGCG -3'
(R):5'- GGCATTCCAAGAACAAGATGTTAC -3'
Posted On2016-06-15