Incidental Mutation 'R5121:Myo15b'
ID393053
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Namemyosin XVB
SynonymsLOC217328, E330039G21Rik, LOC380737
MMRRC Submission 042709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5121 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115858406-115892603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115886054 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 867 (R867W)
Ref Sequence ENSEMBL: ENSMUSP00000152405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040703] [ENSMUST00000093911] [ENSMUST00000125835] [ENSMUST00000167507] [ENSMUST00000222123]
Predicted Effect probably damaging
Transcript: ENSMUST00000040703
AA Change: R635W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048072
Gene: ENSMUSG00000034427
AA Change: R635W

DomainStartEndE-ValueType
low complexity region 93 111 N/A INTRINSIC
low complexity region 179 213 N/A INTRINSIC
low complexity region 250 289 N/A INTRINSIC
low complexity region 345 370 N/A INTRINSIC
low complexity region 497 511 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
Blast:MYSc 587 775 3e-15 BLAST
SH3 778 835 1.15e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093911
AA Change: R2289W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427
AA Change: R2289W

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125835
SMART Domains Protein: ENSMUSP00000144423
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
SH3 75 132 7e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141947
Predicted Effect probably benign
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222123
AA Change: R867W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,281,650 I234T probably damaging Het
Adam24 A G 8: 40,679,511 E6G probably damaging Het
Amz1 A G 5: 140,744,164 D151G probably benign Het
Arhgap24 T C 5: 102,841,335 L10P probably damaging Het
Arhgap25 T G 6: 87,532,864 N8T probably benign Het
Arsi T G 18: 60,917,439 F465V probably damaging Het
Atp2c1 A G 9: 105,448,825 V293A probably damaging Het
Bzw2 A G 12: 36,104,351 L340P probably damaging Het
Camkmt C T 17: 85,096,581 T77I probably benign Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Cd163 T C 6: 124,317,989 C671R probably damaging Het
Cdk7 T C 13: 100,717,684 probably null Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Chn2 C T 6: 54,218,561 L72F possibly damaging Het
Cntn2 C A 1: 132,517,060 E363* probably null Het
Crebbp T C 16: 4,093,511 E999G probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Cts3 A C 13: 61,567,595 I141M probably benign Het
Cwc27 A T 13: 104,804,353 V166D probably damaging Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Dnah8 A G 17: 30,810,353 T4099A probably benign Het
Eml6 A G 11: 29,744,606 F1953L probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
Fbln1 A G 15: 85,237,671 E331G probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gcat T C 15: 79,035,282 V149A probably damaging Het
Glp2r A T 11: 67,722,100 probably null Het
Gm572 T C 4: 148,666,845 probably null Het
Golgb1 T C 16: 36,919,258 V2653A probably damaging Het
Grap2 G A 15: 80,646,144 R155Q possibly damaging Het
Gspt1 T A 16: 11,223,301 I533L probably damaging Het
Gypa A T 8: 80,496,348 Y27F unknown Het
Hipk4 G A 7: 27,529,492 V456I probably benign Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Hspa1b A T 17: 34,958,004 V335E possibly damaging Het
Ift122 A G 6: 115,912,534 T827A probably benign Het
Igkv1-35 T C 6: 70,011,135 N58S probably benign Het
Kat6b A T 14: 21,619,258 H297L probably damaging Het
Kirrel3 G T 9: 35,013,305 G296W probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Lrrn1 G T 6: 107,569,207 R655S possibly damaging Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Mill2 G A 7: 18,856,666 G209S probably benign Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mphosph10 A G 7: 64,389,596 S209P probably damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Myb T A 10: 21,126,238 M616L probably benign Het
Myo18b A T 5: 112,874,480 probably benign Het
Nip7 A G 8: 107,056,957 E8G possibly damaging Het
Olfr1318 A T 2: 112,156,286 M112L possibly damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr38 T A 6: 42,762,997 L315* probably null Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr711 T C 7: 106,972,231 I38V probably benign Het
Optn T A 2: 5,046,106 I155F probably benign Het
Papolb A T 5: 142,528,837 H350Q probably benign Het
Pappa2 T A 1: 158,838,627 M1128L probably benign Het
Pcdhb5 T A 18: 37,321,117 N183K probably benign Het
Pde12 G T 14: 26,669,422 S44* probably null Het
Peg3 T C 7: 6,710,289 K645E probably benign Het
Pkd1 C T 17: 24,573,463 R1375C probably benign Het
Plekha5 G A 6: 140,579,474 E21K probably damaging Het
Plk2 C T 13: 110,399,424 P554L probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polg A T 7: 79,464,605 W203R probably damaging Het
Ppcdc A G 9: 57,421,163 V65A possibly damaging Het
Ppm1m T A 9: 106,195,805 Q353L probably benign Het
Ppp1r13l G C 7: 19,370,095 R167P probably damaging Het
Ppp1r9b T A 11: 94,996,653 V497E probably damaging Het
Prpf6 T A 2: 181,636,043 H399Q probably benign Het
Psg25 T A 7: 18,526,536 I146F possibly damaging Het
Rasgef1c A T 11: 49,960,429 Q116L probably damaging Het
Rbbp9 A G 2: 144,550,756 V8A possibly damaging Het
Rfk T C 19: 17,399,566 F144S probably damaging Het
Rfwd3 A C 8: 111,282,753 probably null Het
Rhpn1 T C 15: 75,709,260 I117T probably damaging Het
Sars2 A T 7: 28,747,908 N244Y probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sgcz G A 8: 37,539,667 T195I probably damaging Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Spen T A 4: 141,476,099 Q1739L probably benign Het
Susd1 G T 4: 59,379,657 S323R possibly damaging Het
Szt2 T C 4: 118,385,444 E1482G possibly damaging Het
Tex15 A T 8: 33,571,766 K408I probably damaging Het
Tex33 C T 15: 78,386,173 E132K probably benign Het
Trem1 T A 17: 48,232,836 F14L probably null Het
Trim26 G T 17: 36,851,066 E126* probably null Het
Trpv3 T C 11: 73,277,834 probably null Het
Ttn T A 2: 76,916,491 probably null Het
Ubap1 C T 4: 41,379,688 L301F probably benign Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Vill C T 9: 119,070,025 T253I possibly damaging Het
Vmn2r107 C T 17: 20,355,753 T115I probably benign Het
Vmn2r98 T C 17: 19,053,553 S21P probably benign Het
Wapl A G 14: 34,677,162 K63E probably benign Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Zfp592 T C 7: 81,023,561 L91P probably damaging Het
Zfp74 T C 7: 29,932,507 probably null Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zranb1 A G 7: 132,950,187 E215G probably benign Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115891916 missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115869504 nonsense probably null
IGL01539:Myo15b APN 11 115863473 missense probably benign 0.43
IGL01895:Myo15b APN 11 115883498 missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115886283 missense probably damaging 1.00
IGL02343:Myo15b APN 11 115873400 unclassified probably benign
IGL02349:Myo15b APN 11 115863105 splice site probably benign
IGL02368:Myo15b APN 11 115877002 missense probably benign 0.13
IGL02576:Myo15b APN 11 115890053 missense probably null 0.97
IGL02650:Myo15b APN 11 115886511 critical splice donor site probably null
IGL02661:Myo15b APN 11 115884069 missense probably benign 0.01
IGL02716:Myo15b APN 11 115883709 missense probably benign 0.06
IGL02733:Myo15b APN 11 115884250 missense probably benign 0.00
IGL02951:Myo15b APN 11 115881301 missense probably damaging 1.00
IGL03017:Myo15b APN 11 115887917 missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115871643 missense probably benign 0.08
ANU74:Myo15b UTSW 11 115878413 missense probably damaging 1.00
R0092:Myo15b UTSW 11 115862986 missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115886283 missense probably damaging 1.00
R0325:Myo15b UTSW 11 115884265 missense probably damaging 1.00
R0614:Myo15b UTSW 11 115882913 missense probably damaging 1.00
R0652:Myo15b UTSW 11 115864642 missense probably benign 0.07
R0711:Myo15b UTSW 11 115883838 missense probably damaging 1.00
R0815:Myo15b UTSW 11 115866336 splice site probably benign
R0961:Myo15b UTSW 11 115882454 missense probably benign 0.15
R1066:Myo15b UTSW 11 115879751 missense probably benign 0.03
R1221:Myo15b UTSW 11 115886720 missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115880501 missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115883492 small deletion probably benign
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1317:Myo15b UTSW 11 115883634 missense probably null 0.14
R1491:Myo15b UTSW 11 115886857 splice site probably null
R1552:Myo15b UTSW 11 115866635 missense probably benign 0.08
R1731:Myo15b UTSW 11 115891560 missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115880509 critical splice donor site probably null
R1843:Myo15b UTSW 11 115869586 missense probably benign 0.04
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1894:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1917:Myo15b UTSW 11 115882254 missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115863484 missense probably benign 0.30
R1939:Myo15b UTSW 11 115887703 missense probably benign 0.00
R1945:Myo15b UTSW 11 115878398 missense probably damaging 1.00
R1986:Myo15b UTSW 11 115882875 missense probably benign 0.31
R2130:Myo15b UTSW 11 115871643 missense probably benign 0.08
R2138:Myo15b UTSW 11 115883807 missense probably benign 0.00
R2176:Myo15b UTSW 11 115866572 missense probably damaging 1.00
R2415:Myo15b UTSW 11 115879564 missense probably benign 0.00
R2483:Myo15b UTSW 11 115864739 missense probably benign 0.04
R3620:Myo15b UTSW 11 115871187 missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115863413 missense probably benign 0.01
R4013:Myo15b UTSW 11 115871456 nonsense probably null
R4021:Myo15b UTSW 11 115873505 missense probably benign 0.07
R4119:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4120:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4499:Myo15b UTSW 11 115890952 missense probably benign 0.00
R4653:Myo15b UTSW 11 115879987 critical splice donor site probably null
R4655:Myo15b UTSW 11 115890697 missense probably damaging 1.00
R4700:Myo15b UTSW 11 115861935 missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115884008 missense probably benign 0.01
R4777:Myo15b UTSW 11 115879652 missense probably damaging 0.99
R4833:Myo15b UTSW 11 115887602 missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115866656 missense probably benign 0.01
R5146:Myo15b UTSW 11 115891198 missense probably benign 0.00
R5535:Myo15b UTSW 11 115881301 missense probably damaging 1.00
R5647:Myo15b UTSW 11 115871511 missense probably damaging 0.99
R5849:Myo15b UTSW 11 115881933 missense probably damaging 1.00
R5882:Myo15b UTSW 11 115869596 missense probably damaging 1.00
R5956:Myo15b UTSW 11 115873757 missense probably benign 0.34
R6273:Myo15b UTSW 11 115862799 missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115886239 missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115890831 missense probably damaging 1.00
R6462:Myo15b UTSW 11 115859442 missense probably benign 0.01
R6792:Myo15b UTSW 11 115885097 missense probably damaging 1.00
X0020:Myo15b UTSW 11 115871799 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGACATAATCCTGGGCTTCAG -3'
(R):5'- TTCAACAATGTCAAGGGTCTCCAG -3'

Sequencing Primer
(F):5'- GAGCCTTCTCCGTTGTCC -3'
(R):5'- GGTCTCCAGACTCACCTCCAAG -3'
Posted On2016-06-15