Incidental Mutation 'R5121:Plk2'
ID393057
Institutional Source Beutler Lab
Gene Symbol Plk2
Ensembl Gene ENSMUSG00000021701
Gene Namepolo like kinase 2
SynonymsSnk
MMRRC Submission 042709-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5121 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location110395046-110400844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110399424 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 554 (P554L)
Ref Sequence ENSEMBL: ENSMUSP00000022212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022212]
Predicted Effect probably benign
Transcript: ENSMUST00000022212
AA Change: P554L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000022212
Gene: ENSMUSG00000021701
AA Change: P554L

DomainStartEndE-ValueType
low complexity region 54 62 N/A INTRINSIC
S_TKc 79 331 7.08e-97 SMART
Blast:STYKc 335 383 9e-7 BLAST
low complexity region 448 464 N/A INTRINSIC
Pfam:POLO_box 508 569 2.5e-19 PFAM
Pfam:POLO_box 604 673 1.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225340
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the polo family of serine/threonine protein kinases that have a role in normal cell division. This gene is most abundantly expressed in testis, spleen and fetal tissues, and its expression is inducible by serum, suggesting that it may also play an important role in cells undergoing rapid cell division. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Inactivation of this gene results in impaired embryonic growth and placental defects due to increased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,281,650 I234T probably damaging Het
Adam24 A G 8: 40,679,511 E6G probably damaging Het
Amz1 A G 5: 140,744,164 D151G probably benign Het
Arhgap24 T C 5: 102,841,335 L10P probably damaging Het
Arhgap25 T G 6: 87,532,864 N8T probably benign Het
Arsi T G 18: 60,917,439 F465V probably damaging Het
Atp2c1 A G 9: 105,448,825 V293A probably damaging Het
Bzw2 A G 12: 36,104,351 L340P probably damaging Het
Camkmt C T 17: 85,096,581 T77I probably benign Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Cd163 T C 6: 124,317,989 C671R probably damaging Het
Cdk7 T C 13: 100,717,684 probably null Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Chn2 C T 6: 54,218,561 L72F possibly damaging Het
Cntn2 C A 1: 132,517,060 E363* probably null Het
Crebbp T C 16: 4,093,511 E999G probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Cts3 A C 13: 61,567,595 I141M probably benign Het
Cwc27 A T 13: 104,804,353 V166D probably damaging Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Dnah8 A G 17: 30,810,353 T4099A probably benign Het
Eml6 A G 11: 29,744,606 F1953L probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
Fbln1 A G 15: 85,237,671 E331G probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gcat T C 15: 79,035,282 V149A probably damaging Het
Glp2r A T 11: 67,722,100 probably null Het
Gm572 T C 4: 148,666,845 probably null Het
Golgb1 T C 16: 36,919,258 V2653A probably damaging Het
Grap2 G A 15: 80,646,144 R155Q possibly damaging Het
Gspt1 T A 16: 11,223,301 I533L probably damaging Het
Gypa A T 8: 80,496,348 Y27F unknown Het
Hipk4 G A 7: 27,529,492 V456I probably benign Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Hspa1b A T 17: 34,958,004 V335E possibly damaging Het
Ift122 A G 6: 115,912,534 T827A probably benign Het
Igkv1-35 T C 6: 70,011,135 N58S probably benign Het
Kat6b A T 14: 21,619,258 H297L probably damaging Het
Kirrel3 G T 9: 35,013,305 G296W probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Lrrn1 G T 6: 107,569,207 R655S possibly damaging Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Mill2 G A 7: 18,856,666 G209S probably benign Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mphosph10 A G 7: 64,389,596 S209P probably damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Myb T A 10: 21,126,238 M616L probably benign Het
Myo15b C T 11: 115,886,054 R867W probably damaging Het
Myo18b A T 5: 112,874,480 probably benign Het
Nip7 A G 8: 107,056,957 E8G possibly damaging Het
Olfr1318 A T 2: 112,156,286 M112L possibly damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr38 T A 6: 42,762,997 L315* probably null Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr711 T C 7: 106,972,231 I38V probably benign Het
Optn T A 2: 5,046,106 I155F probably benign Het
Papolb A T 5: 142,528,837 H350Q probably benign Het
Pappa2 T A 1: 158,838,627 M1128L probably benign Het
Pcdhb5 T A 18: 37,321,117 N183K probably benign Het
Pde12 G T 14: 26,669,422 S44* probably null Het
Peg3 T C 7: 6,710,289 K645E probably benign Het
Pkd1 C T 17: 24,573,463 R1375C probably benign Het
Plekha5 G A 6: 140,579,474 E21K probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polg A T 7: 79,464,605 W203R probably damaging Het
Ppcdc A G 9: 57,421,163 V65A possibly damaging Het
Ppm1m T A 9: 106,195,805 Q353L probably benign Het
Ppp1r13l G C 7: 19,370,095 R167P probably damaging Het
Ppp1r9b T A 11: 94,996,653 V497E probably damaging Het
Prpf6 T A 2: 181,636,043 H399Q probably benign Het
Psg25 T A 7: 18,526,536 I146F possibly damaging Het
Rasgef1c A T 11: 49,960,429 Q116L probably damaging Het
Rbbp9 A G 2: 144,550,756 V8A possibly damaging Het
Rfk T C 19: 17,399,566 F144S probably damaging Het
Rfwd3 A C 8: 111,282,753 probably null Het
Rhpn1 T C 15: 75,709,260 I117T probably damaging Het
Sars2 A T 7: 28,747,908 N244Y probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sgcz G A 8: 37,539,667 T195I probably damaging Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Spen T A 4: 141,476,099 Q1739L probably benign Het
Susd1 G T 4: 59,379,657 S323R possibly damaging Het
Szt2 T C 4: 118,385,444 E1482G possibly damaging Het
Tex15 A T 8: 33,571,766 K408I probably damaging Het
Tex33 C T 15: 78,386,173 E132K probably benign Het
Trem1 T A 17: 48,232,836 F14L probably null Het
Trim26 G T 17: 36,851,066 E126* probably null Het
Trpv3 T C 11: 73,277,834 probably null Het
Ttn T A 2: 76,916,491 probably null Het
Ubap1 C T 4: 41,379,688 L301F probably benign Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Vill C T 9: 119,070,025 T253I possibly damaging Het
Vmn2r107 C T 17: 20,355,753 T115I probably benign Het
Vmn2r98 T C 17: 19,053,553 S21P probably benign Het
Wapl A G 14: 34,677,162 K63E probably benign Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Zfp592 T C 7: 81,023,561 L91P probably damaging Het
Zfp74 T C 7: 29,932,507 probably null Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zranb1 A G 7: 132,950,187 E215G probably benign Het
Other mutations in Plk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Plk2 APN 13 110398764 missense probably benign 0.18
IGL00586:Plk2 APN 13 110396378 missense possibly damaging 0.61
IGL00798:Plk2 APN 13 110398034 missense probably benign 0.00
IGL01450:Plk2 APN 13 110396324 missense probably damaging 1.00
IGL01722:Plk2 APN 13 110399442 missense probably benign 0.00
IGL01937:Plk2 APN 13 110399054 missense possibly damaging 0.80
IGL01945:Plk2 APN 13 110399054 missense possibly damaging 0.80
IGL01993:Plk2 APN 13 110399197 missense probably damaging 1.00
IGL02231:Plk2 APN 13 110400069 missense probably benign 0.01
IGL03059:Plk2 APN 13 110399134 missense probably benign 0.42
mite UTSW 13 110396036 nonsense probably null
R0189:Plk2 UTSW 13 110399463 missense probably damaging 1.00
R0324:Plk2 UTSW 13 110397708 missense probably benign 0.08
R1108:Plk2 UTSW 13 110399489 missense probably damaging 0.99
R1422:Plk2 UTSW 13 110399489 missense probably damaging 0.99
R1513:Plk2 UTSW 13 110400088 missense probably benign 0.45
R2987:Plk2 UTSW 13 110397709 missense probably benign 0.03
R4050:Plk2 UTSW 13 110399866 missense probably damaging 1.00
R4211:Plk2 UTSW 13 110396337 missense probably damaging 0.98
R4278:Plk2 UTSW 13 110396103 missense probably benign 0.15
R4777:Plk2 UTSW 13 110397773 missense probably benign
R5677:Plk2 UTSW 13 110399057 missense possibly damaging 0.83
R6240:Plk2 UTSW 13 110399474 missense probably damaging 1.00
R6240:Plk2 UTSW 13 110400034 missense probably damaging 1.00
R6436:Plk2 UTSW 13 110396036 nonsense probably null
R6596:Plk2 UTSW 13 110397762 missense probably benign 0.37
R6776:Plk2 UTSW 13 110399791 missense probably benign
R6938:Plk2 UTSW 13 110396680 nonsense probably null
R7556:Plk2 UTSW 13 110396588 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCAACAACGGGGCTCACATG -3'
(R):5'- TGCATCTAAGATAAGCCCTGAG -3'

Sequencing Primer
(F):5'- ACATGAGCCTCCTTCCGGAC -3'
(R):5'- TAAGATAAGCCCTGAGAAGCTAAAC -3'
Posted On2016-06-15