Incidental Mutation 'R5038:Trpa1'
ID393082
Institutional Source Beutler Lab
Gene Symbol Trpa1
Ensembl Gene ENSMUSG00000032769
Gene Nametransient receptor potential cation channel, subfamily A, member 1
SynonymsANKTM1
MMRRC Submission 042628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5038 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location14872648-14918862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14910866 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 104 (H104L)
Ref Sequence ENSEMBL: ENSMUSP00000043594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041447]
Predicted Effect probably damaging
Transcript: ENSMUST00000041447
AA Change: H104L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043594
Gene: ENSMUSG00000032769
AA Change: H104L

DomainStartEndE-ValueType
ANK 63 94 1.01e2 SMART
ANK 98 127 9.7e-8 SMART
ANK 131 161 1.36e-2 SMART
ANK 165 194 5.45e-2 SMART
ANK 198 226 3.07e2 SMART
ANK 239 268 1.99e-4 SMART
ANK 272 302 1.33e2 SMART
ANK 309 338 4.19e-3 SMART
ANK 342 371 2.34e-1 SMART
ANK 413 442 3.41e-3 SMART
ANK 446 475 5.75e-1 SMART
ANK 482 511 4.1e-6 SMART
ANK 514 543 1.68e-2 SMART
ANK 548 577 4.97e-5 SMART
Blast:ANK 580 609 2e-11 BLAST
Pfam:Ion_trans 736 975 1.8e-11 PFAM
Meta Mutation Damage Score 0.482 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 94% (64/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The structure of the protein encoded by this gene is highly related to both the protein ankyrin and transmembrane proteins. The specific function of this protein has not yet been determined; however, studies indicate the function may involve a role in signal transduction and growth control. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in altered nociception and neuron responses to isothiocyanate or thiosulfinate compounds like those found in mustard oil and garlic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik A T 11: 11,589,375 probably null Het
Abtb2 G T 2: 103,567,063 G113C probably damaging Het
Acsm5 A G 7: 119,534,811 T272A probably damaging Het
Adprhl2 C T 4: 126,317,309 E272K possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Atp7b A C 8: 22,028,456 I122S possibly damaging Het
B230219D22Rik T C 13: 55,699,475 Y134H probably damaging Het
Bnc1 A G 7: 81,968,714 S868P probably damaging Het
Camta1 T C 4: 151,145,469 E302G probably damaging Het
Car1 A G 3: 14,770,873 Y129H probably damaging Het
Cdh22 T C 2: 165,142,277 T352A probably benign Het
Ckmt2 T C 13: 91,861,163 E215G probably benign Het
Cyb5r4 T G 9: 87,059,077 probably null Het
Dhrs13 A G 11: 78,032,430 probably benign Het
Dsg1c G A 18: 20,264,844 A34T probably benign Het
Epb41l1 T C 2: 156,521,410 V613A probably benign Het
Fam114a1 A G 5: 65,009,045 M240V probably damaging Het
Gm15455 T C 1: 33,838,176 noncoding transcript Het
Herc1 T G 9: 66,476,460 probably benign Het
Ifna11 T C 4: 88,820,077 V40A probably benign Het
Ifna15 T C 4: 88,558,029 N73D probably benign Het
Imp4 A T 1: 34,442,935 L45F probably damaging Het
Jak3 G A 8: 71,686,058 A967T probably damaging Het
Krtap19-2 A T 16: 88,874,028 Y76* probably null Het
Map4k5 A T 12: 69,824,614 N492K probably damaging Het
Mycbp2 C T 14: 103,296,939 R372H probably damaging Het
Nos2 G A 11: 78,922,314 S16N probably benign Het
Nr2c2 A G 6: 92,139,822 T2A probably damaging Het
Nup188 T C 2: 30,309,220 Y267H probably damaging Het
Nxph2 G A 2: 23,321,544 probably null Het
Olfr1446 T A 19: 12,890,406 H57L probably damaging Het
Olfr1461 T A 19: 13,165,591 D192E probably benign Het
Olfr1505 T A 19: 13,919,458 V146E possibly damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Pik3r1 C T 13: 101,689,444 R37Q probably damaging Het
Pkn3 T C 2: 30,085,281 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Ptpn14 T C 1: 189,786,886 S38P probably damaging Het
Raf1 G A 6: 115,620,235 Q35* probably null Het
Rps3a1 C A 3: 86,138,031 E251D probably benign Het
Scd1 C T 19: 44,401,709 V207M probably damaging Het
Shq1 A G 6: 100,630,993 V319A probably benign Het
Slc4a8 T C 15: 100,795,821 Y416H probably damaging Het
Slco1a5 T C 6: 142,262,637 T143A probably benign Het
Slco1a5 C T 6: 142,266,364 G90D probably damaging Het
Snx9 T C 17: 5,887,073 V30A probably benign Het
Spdya T C 17: 71,588,566 probably benign Het
Stat1 A T 1: 52,123,209 N75I probably damaging Het
Sv2b A T 7: 75,157,425 M159K probably damaging Het
Tdh A T 14: 63,496,126 Y89* probably null Het
Tmc7 A G 7: 118,543,365 F600S probably damaging Het
Ttn G A 2: 76,848,640 probably benign Het
Vmn1r113 A G 7: 20,787,494 I70M possibly damaging Het
Vmn1r171 A G 7: 23,632,763 M138V probably benign Het
Zfc3h1 G A 10: 115,404,211 V550I probably benign Het
Zfp335 G T 2: 164,910,644 S60* probably null Het
Zfp7 T C 15: 76,891,810 M684T probably benign Het
Zfp984 T A 4: 147,755,446 H316L probably damaging Het
Zmym2 T A 14: 56,956,180 Y1151N possibly damaging Het
Other mutations in Trpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Trpa1 APN 1 14891333 missense probably damaging 0.97
IGL00937:Trpa1 APN 1 14880277 splice site probably benign
IGL00957:Trpa1 APN 1 14881668 missense probably damaging 0.99
IGL01307:Trpa1 APN 1 14896547 missense probably benign 0.23
IGL01336:Trpa1 APN 1 14886880 splice site probably benign
IGL01408:Trpa1 APN 1 14889413 missense probably benign 0.03
IGL01504:Trpa1 APN 1 14882219 missense possibly damaging 0.79
IGL01543:Trpa1 APN 1 14900076 missense probably damaging 1.00
IGL01609:Trpa1 APN 1 14912383 missense probably damaging 0.99
IGL01895:Trpa1 APN 1 14887643 missense possibly damaging 0.87
IGL02449:Trpa1 APN 1 14898157 missense probably damaging 1.00
IGL02936:Trpa1 APN 1 14875969 splice site probably null
fear-2 UTSW 1 14891303 critical splice donor site probably null
petrified UTSW 1 14884116 missense probably damaging 1.00
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0317:Trpa1 UTSW 1 14881632 missense probably benign 0.03
R0454:Trpa1 UTSW 1 14885748 critical splice donor site probably null
R0828:Trpa1 UTSW 1 14875884 missense probably damaging 1.00
R0944:Trpa1 UTSW 1 14912361 splice site probably null
R0962:Trpa1 UTSW 1 14898163 missense possibly damaging 0.61
R1025:Trpa1 UTSW 1 14904183 missense probably benign 0.01
R1035:Trpa1 UTSW 1 14891303 critical splice donor site probably null
R1134:Trpa1 UTSW 1 14881748 missense possibly damaging 0.95
R1278:Trpa1 UTSW 1 14918723 critical splice donor site probably null
R1497:Trpa1 UTSW 1 14885812 missense probably benign 0.30
R1617:Trpa1 UTSW 1 14873675 missense probably damaging 1.00
R1800:Trpa1 UTSW 1 14874424 missense probably benign 0.04
R1856:Trpa1 UTSW 1 14899388 nonsense probably null
R1886:Trpa1 UTSW 1 14889425 missense probably benign 0.00
R2004:Trpa1 UTSW 1 14905983 missense possibly damaging 0.83
R2152:Trpa1 UTSW 1 14899401 missense probably damaging 1.00
R2172:Trpa1 UTSW 1 14881656 missense probably benign 0.01
R2198:Trpa1 UTSW 1 14910746 missense probably benign
R2221:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2223:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2307:Trpa1 UTSW 1 14912381 missense probably benign 0.00
R2338:Trpa1 UTSW 1 14884245 missense probably damaging 0.97
R2698:Trpa1 UTSW 1 14905998 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2873:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2874:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R3418:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3419:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3796:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R3799:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R4238:Trpa1 UTSW 1 14884116 missense probably damaging 1.00
R4320:Trpa1 UTSW 1 14874452 missense probably benign 0.00
R4591:Trpa1 UTSW 1 14882108 splice site probably null
R4834:Trpa1 UTSW 1 14896523 missense possibly damaging 0.72
R4991:Trpa1 UTSW 1 14910746 missense probably benign 0.00
R4999:Trpa1 UTSW 1 14875861 missense probably benign 0.05
R5055:Trpa1 UTSW 1 14875959 missense probably damaging 1.00
R5158:Trpa1 UTSW 1 14881661 missense probably benign 0.01
R5193:Trpa1 UTSW 1 14875917 missense possibly damaging 0.92
R5558:Trpa1 UTSW 1 14898268 missense probably damaging 1.00
R5578:Trpa1 UTSW 1 14887008 missense probably damaging 1.00
R5680:Trpa1 UTSW 1 14875854 missense probably benign 0.00
R5738:Trpa1 UTSW 1 14875950 missense probably damaging 1.00
R5801:Trpa1 UTSW 1 14898078 missense probably damaging 1.00
R5945:Trpa1 UTSW 1 14898135 missense probably benign 0.03
R6092:Trpa1 UTSW 1 14889486 missense probably damaging 1.00
R6776:Trpa1 UTSW 1 14912377 missense probably benign
R7126:Trpa1 UTSW 1 14890424 missense probably benign 0.00
R7154:Trpa1 UTSW 1 14882233 missense possibly damaging 0.46
R7175:Trpa1 UTSW 1 14893207 missense possibly damaging 0.90
R7258:Trpa1 UTSW 1 14903249 missense probably damaging 1.00
R7358:Trpa1 UTSW 1 14898110 missense probably damaging 1.00
R7412:Trpa1 UTSW 1 14884198 missense probably benign 0.43
X0028:Trpa1 UTSW 1 14890420 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATGTGGATTCTGGCCTAGCTC -3'
(R):5'- TGTCCATTGGGTAATTCTGAAGC -3'

Sequencing Primer
(F):5'- GATTCTGGCCTAGCTCCACAG -3'
(R):5'- CCATTGGGTAATTCTGAAGCTAAAAC -3'
Posted On2016-06-15