Incidental Mutation 'R5038:Stat1'
ID393085
Institutional Source Beutler Lab
Gene Symbol Stat1
Ensembl Gene ENSMUSG00000026104
Gene Namesignal transducer and activator of transcription 1
Synonyms2010005J02Rik
MMRRC Submission 042628-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5038 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location52119440-52161865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52123209 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 75 (N75I)
Ref Sequence ENSEMBL: ENSMUSP00000141144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070968] [ENSMUST00000186057] [ENSMUST00000186574] [ENSMUST00000186857] [ENSMUST00000188681] [ENSMUST00000189347] [ENSMUST00000191435]
Predicted Effect probably damaging
Transcript: ENSMUST00000070968
AA Change: N75I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066743
Gene: ENSMUSG00000026104
AA Change: N75I

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 139 315 1.4e-56 PFAM
Pfam:STAT_bind 317 566 4.2e-82 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 2.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185743
Predicted Effect probably damaging
Transcript: ENSMUST00000186057
AA Change: N75I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141132
Gene: ENSMUSG00000026104
AA Change: N75I

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 3.4e-65 PFAM
Pfam:STAT_bind 317 573 3.9e-118 PFAM
SH2 577 693 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 721 745 2.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186186
Predicted Effect probably damaging
Transcript: ENSMUST00000186574
AA Change: N75I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140518
Gene: ENSMUSG00000026104
AA Change: N75I

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186857
AA Change: N75I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140875
Gene: ENSMUSG00000026104
AA Change: N75I

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 1.2e-64 PFAM
Pfam:STAT_bind 317 567 4.4e-121 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 3.1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188681
AA Change: N75I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141144
Gene: ENSMUSG00000026104
AA Change: N75I

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189347
AA Change: N75I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141125
Gene: ENSMUSG00000026104
AA Change: N75I

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191435
AA Change: N75I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139746
Gene: ENSMUSG00000026104
AA Change: N75I

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 94% (64/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. Two alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are largely unresponsive to interferon, fail to thrive, are susceptible to viral diseases and cutaneous leishmaniasis, and show excess osteoclastogenesis leading to increased bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik A T 11: 11,589,375 probably null Het
Abtb2 G T 2: 103,567,063 G113C probably damaging Het
Acsm5 A G 7: 119,534,811 T272A probably damaging Het
Adprhl2 C T 4: 126,317,309 E272K possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Atp7b A C 8: 22,028,456 I122S possibly damaging Het
B230219D22Rik T C 13: 55,699,475 Y134H probably damaging Het
Bnc1 A G 7: 81,968,714 S868P probably damaging Het
Camta1 T C 4: 151,145,469 E302G probably damaging Het
Car1 A G 3: 14,770,873 Y129H probably damaging Het
Cdh22 T C 2: 165,142,277 T352A probably benign Het
Ckmt2 T C 13: 91,861,163 E215G probably benign Het
Cyb5r4 T G 9: 87,059,077 probably null Het
Dhrs13 A G 11: 78,032,430 probably benign Het
Dsg1c G A 18: 20,264,844 A34T probably benign Het
Epb41l1 T C 2: 156,521,410 V613A probably benign Het
Fam114a1 A G 5: 65,009,045 M240V probably damaging Het
Gm15455 T C 1: 33,838,176 noncoding transcript Het
Herc1 T G 9: 66,476,460 probably benign Het
Ifna11 T C 4: 88,820,077 V40A probably benign Het
Ifna15 T C 4: 88,558,029 N73D probably benign Het
Imp4 A T 1: 34,442,935 L45F probably damaging Het
Jak3 G A 8: 71,686,058 A967T probably damaging Het
Krtap19-2 A T 16: 88,874,028 Y76* probably null Het
Map4k5 A T 12: 69,824,614 N492K probably damaging Het
Mycbp2 C T 14: 103,296,939 R372H probably damaging Het
Nos2 G A 11: 78,922,314 S16N probably benign Het
Nr2c2 A G 6: 92,139,822 T2A probably damaging Het
Nup188 T C 2: 30,309,220 Y267H probably damaging Het
Nxph2 G A 2: 23,321,544 probably null Het
Olfr1446 T A 19: 12,890,406 H57L probably damaging Het
Olfr1461 T A 19: 13,165,591 D192E probably benign Het
Olfr1505 T A 19: 13,919,458 V146E possibly damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Pik3r1 C T 13: 101,689,444 R37Q probably damaging Het
Pkn3 T C 2: 30,085,281 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Ptpn14 T C 1: 189,786,886 S38P probably damaging Het
Raf1 G A 6: 115,620,235 Q35* probably null Het
Rps3a1 C A 3: 86,138,031 E251D probably benign Het
Scd1 C T 19: 44,401,709 V207M probably damaging Het
Shq1 A G 6: 100,630,993 V319A probably benign Het
Slc4a8 T C 15: 100,795,821 Y416H probably damaging Het
Slco1a5 T C 6: 142,262,637 T143A probably benign Het
Slco1a5 C T 6: 142,266,364 G90D probably damaging Het
Snx9 T C 17: 5,887,073 V30A probably benign Het
Spdya T C 17: 71,588,566 probably benign Het
Sv2b A T 7: 75,157,425 M159K probably damaging Het
Tdh A T 14: 63,496,126 Y89* probably null Het
Tmc7 A G 7: 118,543,365 F600S probably damaging Het
Trpa1 T A 1: 14,910,866 H104L probably damaging Het
Ttn G A 2: 76,848,640 probably benign Het
Vmn1r113 A G 7: 20,787,494 I70M possibly damaging Het
Vmn1r171 A G 7: 23,632,763 M138V probably benign Het
Zfc3h1 G A 10: 115,404,211 V550I probably benign Het
Zfp335 G T 2: 164,910,644 S60* probably null Het
Zfp7 T C 15: 76,891,810 M684T probably benign Het
Zfp984 T A 4: 147,755,446 H316L probably damaging Het
Zmym2 T A 14: 56,956,180 Y1151N possibly damaging Het
Other mutations in Stat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Stat1 APN 1 52122595 start codon destroyed probably null 0.50
IGL01111:Stat1 APN 1 52142961 critical splice donor site probably null
IGL01451:Stat1 APN 1 52139343 missense probably damaging 1.00
IGL01469:Stat1 APN 1 52147370 missense possibly damaging 0.87
IGL01758:Stat1 APN 1 52136921 missense probably damaging 1.00
IGL01818:Stat1 APN 1 52151278 missense probably damaging 1.00
IGL01913:Stat1 APN 1 52126557 missense probably benign 0.08
IGL01914:Stat1 APN 1 52126557 missense probably benign 0.08
IGL02304:Stat1 APN 1 52132544 missense probably benign
IGL02428:Stat1 APN 1 52142966 splice site probably benign
domino UTSW 1 52140588 missense probably damaging 1.00
poison UTSW 1 52151225 splice site probably benign
roccoco UTSW 1 52123209 missense probably damaging 1.00
rollo UTSW 1 52153923 nonsense probably null
special UTSW 1 52139264 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0039:Stat1 UTSW 1 52140660 missense probably damaging 0.99
R0458:Stat1 UTSW 1 52149052 splice site probably benign
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R2998:Stat1 UTSW 1 52151249 missense probably benign 0.01
R4464:Stat1 UTSW 1 52137416 missense possibly damaging 0.52
R4709:Stat1 UTSW 1 52126521 missense probably damaging 0.97
R4934:Stat1 UTSW 1 52153923 nonsense probably null
R5075:Stat1 UTSW 1 52122712 missense possibly damaging 0.73
R5223:Stat1 UTSW 1 52144242 missense probably damaging 1.00
R5600:Stat1 UTSW 1 52148942 missense probably benign 0.06
R5866:Stat1 UTSW 1 52139264 missense probably damaging 1.00
R7105:Stat1 UTSW 1 52151249 missense probably benign 0.01
R7192:Stat1 UTSW 1 52135621 missense possibly damaging 0.65
R7284:Stat1 UTSW 1 52148922 missense probably benign 0.01
R7309:Stat1 UTSW 1 52126621 splice site probably null
X0027:Stat1 UTSW 1 52139271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATGTCTGGCACTTCCTATAC -3'
(R):5'- CAGCCACATAAAGAGAGTGTATCTG -3'

Sequencing Primer
(F):5'- GTCAGTTGTGTGTGATAGAAACAC -3'
(R):5'- AGAGAGTGTATCTGTACTTCTGTAAC -3'
Posted On2016-06-15