Incidental Mutation 'R5038:Car1'
ID393095
Institutional Source Beutler Lab
Gene Symbol Car1
Ensembl Gene ENSMUSG00000027556
Gene Namecarbonic anhydrase 1
SynonymsCar-1, CA I
MMRRC Submission 042628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5038 (G1)
Quality Score194
Status Validated
Chromosome3
Chromosomal Location14766216-14808368 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14770873 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 129 (Y129H)
Ref Sequence ENSEMBL: ENSMUSP00000137926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094365] [ENSMUST00000144327] [ENSMUST00000181860]
Predicted Effect probably damaging
Transcript: ENSMUST00000094365
AA Change: Y129H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091925
Gene: ENSMUSG00000027556
AA Change: Y129H

DomainStartEndE-ValueType
Carb_anhydrase 6 261 2e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144327
AA Change: Y63H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120495
Gene: ENSMUSG00000027556
AA Change: Y63H

DomainStartEndE-ValueType
Carb_anhydrase 6 92 2.08e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181860
AA Change: Y129H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137926
Gene: ENSMUSG00000027556
AA Change: Y129H

DomainStartEndE-ValueType
Carb_anhydrase 6 261 2e-133 SMART
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 94% (64/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This CA1 gene is closely linked to the CA2 and CA3 genes on chromosome 8. It encodes a cytosolic protein that is found at the highest level in erythrocytes. Allelic variants of this gene have been described in some populations. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: This locus controls electrophoretic variation in red blood cells. The a allele determines a slow migrating form in C57BL/6, C3H/He and other strains; the b allele determines a fast form in IS/Cam, WB/Re, SM, M. m. castaneus and M. m. molossinus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik A T 11: 11,589,375 probably null Het
Abtb2 G T 2: 103,567,063 G113C probably damaging Het
Acsm5 A G 7: 119,534,811 T272A probably damaging Het
Adprhl2 C T 4: 126,317,309 E272K possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Atp7b A C 8: 22,028,456 I122S possibly damaging Het
B230219D22Rik T C 13: 55,699,475 Y134H probably damaging Het
Bnc1 A G 7: 81,968,714 S868P probably damaging Het
Camta1 T C 4: 151,145,469 E302G probably damaging Het
Cdh22 T C 2: 165,142,277 T352A probably benign Het
Ckmt2 T C 13: 91,861,163 E215G probably benign Het
Cyb5r4 T G 9: 87,059,077 probably null Het
Dhrs13 A G 11: 78,032,430 probably benign Het
Dsg1c G A 18: 20,264,844 A34T probably benign Het
Epb41l1 T C 2: 156,521,410 V613A probably benign Het
Fam114a1 A G 5: 65,009,045 M240V probably damaging Het
Gm15455 T C 1: 33,838,176 noncoding transcript Het
Herc1 T G 9: 66,476,460 probably benign Het
Ifna11 T C 4: 88,820,077 V40A probably benign Het
Ifna15 T C 4: 88,558,029 N73D probably benign Het
Imp4 A T 1: 34,442,935 L45F probably damaging Het
Jak3 G A 8: 71,686,058 A967T probably damaging Het
Krtap19-2 A T 16: 88,874,028 Y76* probably null Het
Map4k5 A T 12: 69,824,614 N492K probably damaging Het
Mycbp2 C T 14: 103,296,939 R372H probably damaging Het
Nos2 G A 11: 78,922,314 S16N probably benign Het
Nr2c2 A G 6: 92,139,822 T2A probably damaging Het
Nup188 T C 2: 30,309,220 Y267H probably damaging Het
Nxph2 G A 2: 23,321,544 probably null Het
Olfr1446 T A 19: 12,890,406 H57L probably damaging Het
Olfr1461 T A 19: 13,165,591 D192E probably benign Het
Olfr1505 T A 19: 13,919,458 V146E possibly damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Pik3r1 C T 13: 101,689,444 R37Q probably damaging Het
Pkn3 T C 2: 30,085,281 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Ptpn14 T C 1: 189,786,886 S38P probably damaging Het
Raf1 G A 6: 115,620,235 Q35* probably null Het
Rps3a1 C A 3: 86,138,031 E251D probably benign Het
Scd1 C T 19: 44,401,709 V207M probably damaging Het
Shq1 A G 6: 100,630,993 V319A probably benign Het
Slc4a8 T C 15: 100,795,821 Y416H probably damaging Het
Slco1a5 T C 6: 142,262,637 T143A probably benign Het
Slco1a5 C T 6: 142,266,364 G90D probably damaging Het
Snx9 T C 17: 5,887,073 V30A probably benign Het
Spdya T C 17: 71,588,566 probably benign Het
Stat1 A T 1: 52,123,209 N75I probably damaging Het
Sv2b A T 7: 75,157,425 M159K probably damaging Het
Tdh A T 14: 63,496,126 Y89* probably null Het
Tmc7 A G 7: 118,543,365 F600S probably damaging Het
Trpa1 T A 1: 14,910,866 H104L probably damaging Het
Ttn G A 2: 76,848,640 probably benign Het
Vmn1r113 A G 7: 20,787,494 I70M possibly damaging Het
Vmn1r171 A G 7: 23,632,763 M138V probably benign Het
Zfc3h1 G A 10: 115,404,211 V550I probably benign Het
Zfp335 G T 2: 164,910,644 S60* probably null Het
Zfp7 T C 15: 76,891,810 M684T probably benign Het
Zfp984 T A 4: 147,755,446 H316L probably damaging Het
Zmym2 T A 14: 56,956,180 Y1151N possibly damaging Het
Other mutations in Car1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01749:Car1 APN 3 14767459 missense probably benign 0.00
IGL02975:Car1 APN 3 14777822 missense probably benign 0.31
R0432:Car1 UTSW 3 14770176 missense probably benign 0.03
R1637:Car1 UTSW 3 14777786 missense possibly damaging 0.81
R2244:Car1 UTSW 3 14770852 missense possibly damaging 0.50
R5036:Car1 UTSW 3 14776239 missense possibly damaging 0.86
R5441:Car1 UTSW 3 14776304 missense probably damaging 1.00
R7477:Car1 UTSW 3 14776283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGATGATGGCTTCTATCAG -3'
(R):5'- CCTTTGCATCAGTACTTGTCACAAATG -3'

Sequencing Primer
(F):5'- GATGATGGCTTCTATCAGAGAATTTC -3'
(R):5'- GGGGACTGTTATTCAAATCTAGCAGC -3'
Posted On2016-06-15