Incidental Mutation 'R5038:Ifna15'
ID393097
Institutional Source Beutler Lab
Gene Symbol Ifna15
Ensembl Gene ENSMUSG00000096011
Gene Nameinterferon alpha 15
SynonymsIfnaa, Gm12597
MMRRC Submission 042628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5038 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location88557673-88558245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88558029 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 73 (N73D)
Ref Sequence ENSEMBL: ENSMUSP00000099873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102809]
Predicted Effect probably benign
Transcript: ENSMUST00000102809
AA Change: N73D

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099873
Gene: ENSMUSG00000096011
AA Change: N73D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IFabd 58 175 2.97e-68 SMART
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 94% (64/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik A T 11: 11,589,375 probably null Het
Abtb2 G T 2: 103,567,063 G113C probably damaging Het
Acsm5 A G 7: 119,534,811 T272A probably damaging Het
Adprhl2 C T 4: 126,317,309 E272K possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Atp7b A C 8: 22,028,456 I122S possibly damaging Het
B230219D22Rik T C 13: 55,699,475 Y134H probably damaging Het
Bnc1 A G 7: 81,968,714 S868P probably damaging Het
Camta1 T C 4: 151,145,469 E302G probably damaging Het
Car1 A G 3: 14,770,873 Y129H probably damaging Het
Cdh22 T C 2: 165,142,277 T352A probably benign Het
Ckmt2 T C 13: 91,861,163 E215G probably benign Het
Cyb5r4 T G 9: 87,059,077 probably null Het
Dhrs13 A G 11: 78,032,430 probably benign Het
Dsg1c G A 18: 20,264,844 A34T probably benign Het
Epb41l1 T C 2: 156,521,410 V613A probably benign Het
Fam114a1 A G 5: 65,009,045 M240V probably damaging Het
Gm15455 T C 1: 33,838,176 noncoding transcript Het
Herc1 T G 9: 66,476,460 probably benign Het
Ifna11 T C 4: 88,820,077 V40A probably benign Het
Imp4 A T 1: 34,442,935 L45F probably damaging Het
Jak3 G A 8: 71,686,058 A967T probably damaging Het
Krtap19-2 A T 16: 88,874,028 Y76* probably null Het
Map4k5 A T 12: 69,824,614 N492K probably damaging Het
Mycbp2 C T 14: 103,296,939 R372H probably damaging Het
Nos2 G A 11: 78,922,314 S16N probably benign Het
Nr2c2 A G 6: 92,139,822 T2A probably damaging Het
Nup188 T C 2: 30,309,220 Y267H probably damaging Het
Nxph2 G A 2: 23,321,544 probably null Het
Olfr1446 T A 19: 12,890,406 H57L probably damaging Het
Olfr1461 T A 19: 13,165,591 D192E probably benign Het
Olfr1505 T A 19: 13,919,458 V146E possibly damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Pik3r1 C T 13: 101,689,444 R37Q probably damaging Het
Pkn3 T C 2: 30,085,281 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Ptpn14 T C 1: 189,786,886 S38P probably damaging Het
Raf1 G A 6: 115,620,235 Q35* probably null Het
Rps3a1 C A 3: 86,138,031 E251D probably benign Het
Scd1 C T 19: 44,401,709 V207M probably damaging Het
Shq1 A G 6: 100,630,993 V319A probably benign Het
Slc4a8 T C 15: 100,795,821 Y416H probably damaging Het
Slco1a5 T C 6: 142,262,637 T143A probably benign Het
Slco1a5 C T 6: 142,266,364 G90D probably damaging Het
Snx9 T C 17: 5,887,073 V30A probably benign Het
Spdya T C 17: 71,588,566 probably benign Het
Stat1 A T 1: 52,123,209 N75I probably damaging Het
Sv2b A T 7: 75,157,425 M159K probably damaging Het
Tdh A T 14: 63,496,126 Y89* probably null Het
Tmc7 A G 7: 118,543,365 F600S probably damaging Het
Trpa1 T A 1: 14,910,866 H104L probably damaging Het
Ttn G A 2: 76,848,640 probably benign Het
Vmn1r113 A G 7: 20,787,494 I70M possibly damaging Het
Vmn1r171 A G 7: 23,632,763 M138V probably benign Het
Zfc3h1 G A 10: 115,404,211 V550I probably benign Het
Zfp335 G T 2: 164,910,644 S60* probably null Het
Zfp7 T C 15: 76,891,810 M684T probably benign Het
Zfp984 T A 4: 147,755,446 H316L probably damaging Het
Zmym2 T A 14: 56,956,180 Y1151N possibly damaging Het
Other mutations in Ifna15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Ifna15 APN 4 88557807 missense probably damaging 1.00
IGL01757:Ifna15 APN 4 88558085 missense possibly damaging 0.79
IGL01824:Ifna15 APN 4 88557783 missense probably benign 0.00
R3853:Ifna15 UTSW 4 88557809 missense probably damaging 1.00
R4356:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R4357:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R4358:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R4359:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R5372:Ifna15 UTSW 4 88558101 missense probably damaging 0.97
R6036:Ifna15 UTSW 4 88558073 missense possibly damaging 0.65
R6036:Ifna15 UTSW 4 88558073 missense possibly damaging 0.65
R7347:Ifna15 UTSW 4 88557983 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCAGCAGGTAGTCTTC -3'
(R):5'- CCCTGCTAGTGATGAGCTAC -3'

Sequencing Primer
(F):5'- CAGGTAGTCTTCCTGGGTCAG -3'
(R):5'- TGAGCTACTGGTCAACCTGC -3'
Posted On2016-06-15