Incidental Mutation 'R5038:Ckmt2'
ID393126
Institutional Source Beutler Lab
Gene Symbol Ckmt2
Ensembl Gene ENSMUSG00000021622
Gene Namecreatine kinase, mitochondrial 2
SynonymsScCKmit, 2300008A19Rik
MMRRC Submission 042628-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R5038 (G1)
Quality Score219
Status Validated
Chromosome13
Chromosomal Location91853387-91876885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91861163 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 215 (E215G)
Ref Sequence ENSEMBL: ENSMUSP00000022122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022122]
Predicted Effect probably benign
Transcript: ENSMUST00000022122
AA Change: E215G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000022122
Gene: ENSMUSG00000021622
AA Change: E215G

DomainStartEndE-ValueType
Pfam:ATP-gua_PtransN 58 133 3.4e-35 PFAM
Pfam:ATP-gua_Ptrans 154 401 1.3e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189130
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 94% (64/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial creatine kinase (MtCK) is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK and ubiquitous MtCK, encoded by separate genes. Mitochondrial creatine kinase occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Sarcomeric mitochondrial creatine kinase has 80% homology with the coding exons of ubiquitous mitochondrial creatine kinase. This gene contains sequences homologous to several motifs that are shared among some nuclear genes encoding mitochondrial proteins and thus may be essential for the coordinated activation of these genes during mitochondrial biogenesis. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: The hearts of mice homozygous for disruptions of this gene have hypertrophic and dilated left ventricles exhibit functional abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik A T 11: 11,589,375 probably null Het
Abtb2 G T 2: 103,567,063 G113C probably damaging Het
Acsm5 A G 7: 119,534,811 T272A probably damaging Het
Adprhl2 C T 4: 126,317,309 E272K possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Atp7b A C 8: 22,028,456 I122S possibly damaging Het
B230219D22Rik T C 13: 55,699,475 Y134H probably damaging Het
Bnc1 A G 7: 81,968,714 S868P probably damaging Het
Camta1 T C 4: 151,145,469 E302G probably damaging Het
Car1 A G 3: 14,770,873 Y129H probably damaging Het
Cdh22 T C 2: 165,142,277 T352A probably benign Het
Cyb5r4 T G 9: 87,059,077 probably null Het
Dhrs13 A G 11: 78,032,430 probably benign Het
Dsg1c G A 18: 20,264,844 A34T probably benign Het
Epb41l1 T C 2: 156,521,410 V613A probably benign Het
Fam114a1 A G 5: 65,009,045 M240V probably damaging Het
Gm15455 T C 1: 33,838,176 noncoding transcript Het
Herc1 T G 9: 66,476,460 probably benign Het
Ifna11 T C 4: 88,820,077 V40A probably benign Het
Ifna15 T C 4: 88,558,029 N73D probably benign Het
Imp4 A T 1: 34,442,935 L45F probably damaging Het
Jak3 G A 8: 71,686,058 A967T probably damaging Het
Krtap19-2 A T 16: 88,874,028 Y76* probably null Het
Map4k5 A T 12: 69,824,614 N492K probably damaging Het
Mycbp2 C T 14: 103,296,939 R372H probably damaging Het
Nos2 G A 11: 78,922,314 S16N probably benign Het
Nr2c2 A G 6: 92,139,822 T2A probably damaging Het
Nup188 T C 2: 30,309,220 Y267H probably damaging Het
Nxph2 G A 2: 23,321,544 probably null Het
Olfr1446 T A 19: 12,890,406 H57L probably damaging Het
Olfr1461 T A 19: 13,165,591 D192E probably benign Het
Olfr1505 T A 19: 13,919,458 V146E possibly damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Pik3r1 C T 13: 101,689,444 R37Q probably damaging Het
Pkn3 T C 2: 30,085,281 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Ptpn14 T C 1: 189,786,886 S38P probably damaging Het
Raf1 G A 6: 115,620,235 Q35* probably null Het
Rps3a1 C A 3: 86,138,031 E251D probably benign Het
Scd1 C T 19: 44,401,709 V207M probably damaging Het
Shq1 A G 6: 100,630,993 V319A probably benign Het
Slc4a8 T C 15: 100,795,821 Y416H probably damaging Het
Slco1a5 T C 6: 142,262,637 T143A probably benign Het
Slco1a5 C T 6: 142,266,364 G90D probably damaging Het
Snx9 T C 17: 5,887,073 V30A probably benign Het
Spdya T C 17: 71,588,566 probably benign Het
Stat1 A T 1: 52,123,209 N75I probably damaging Het
Sv2b A T 7: 75,157,425 M159K probably damaging Het
Tdh A T 14: 63,496,126 Y89* probably null Het
Tmc7 A G 7: 118,543,365 F600S probably damaging Het
Trpa1 T A 1: 14,910,866 H104L probably damaging Het
Ttn G A 2: 76,848,640 probably benign Het
Vmn1r113 A G 7: 20,787,494 I70M possibly damaging Het
Vmn1r171 A G 7: 23,632,763 M138V probably benign Het
Zfc3h1 G A 10: 115,404,211 V550I probably benign Het
Zfp335 G T 2: 164,910,644 S60* probably null Het
Zfp7 T C 15: 76,891,810 M684T probably benign Het
Zfp984 T A 4: 147,755,446 H316L probably damaging Het
Zmym2 T A 14: 56,956,180 Y1151N possibly damaging Het
Other mutations in Ckmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ckmt2 APN 13 91863263 missense probably damaging 1.00
IGL01359:Ckmt2 APN 13 91861820 missense probably damaging 1.00
IGL02138:Ckmt2 APN 13 91861828 missense probably benign 0.44
IGL02372:Ckmt2 APN 13 91865224 missense probably benign 0.02
IGL02415:Ckmt2 APN 13 91863340 splice site probably benign
IGL02714:Ckmt2 APN 13 91858308 missense possibly damaging 0.64
IGL02866:Ckmt2 APN 13 91858281 nonsense probably null
R0329:Ckmt2 UTSW 13 91863203 missense possibly damaging 0.93
R0330:Ckmt2 UTSW 13 91863203 missense possibly damaging 0.93
R0593:Ckmt2 UTSW 13 91853638 missense probably damaging 0.99
R1438:Ckmt2 UTSW 13 91859852 splice site probably benign
R1529:Ckmt2 UTSW 13 91861201 missense probably benign
R1616:Ckmt2 UTSW 13 91859209 missense probably benign 0.16
R2114:Ckmt2 UTSW 13 91855845 missense probably benign 0.05
R2117:Ckmt2 UTSW 13 91855845 missense probably benign 0.05
R4300:Ckmt2 UTSW 13 91863338 critical splice acceptor site probably null
R5322:Ckmt2 UTSW 13 91861772 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GCCCAGCACTCATACTGAAG -3'
(R):5'- TCACGGGCAGTTTGATGAG -3'

Sequencing Primer
(F):5'- CCTAGTCCTACAGTGACATGATGG -3'
(R):5'- ATGAGCGCTATGTGTTGTCCTCTC -3'
Posted On2016-06-15