Incidental Mutation 'R5038:Zfp7'
ID393130
Institutional Source Beutler Lab
Gene Symbol Zfp7
Ensembl Gene ENSMUSG00000033669
Gene Namezinc finger protein 7
SynonymsKRAB20, Zfp-7, Zfp86-rs1, Zfp65, Zfp80, KRAB7, Krox-2, mszf73-2
MMRRC Submission 042628-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5038 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76879259-76892395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76891810 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 684 (M684T)
Ref Sequence ENSEMBL: ENSMUSP00000155599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023179] [ENSMUST00000229831] [ENSMUST00000229990] [ENSMUST00000230106] [ENSMUST00000230214]
Predicted Effect probably benign
Transcript: ENSMUST00000023179
AA Change: M684T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000023179
Gene: ENSMUSG00000033669
AA Change: M684T

DomainStartEndE-ValueType
KRAB 4 65 3.07e-33 SMART
ZnF_C2H2 192 214 6.88e-4 SMART
ZnF_C2H2 220 242 4.24e-4 SMART
ZnF_C2H2 248 270 2.09e-3 SMART
ZnF_C2H2 276 298 1.45e-2 SMART
ZnF_C2H2 304 326 1.13e-4 SMART
ZnF_C2H2 332 354 9.08e-4 SMART
ZnF_C2H2 360 383 2.24e-3 SMART
ZnF_C2H2 412 434 9.08e-4 SMART
ZnF_C2H2 440 462 1.67e-2 SMART
ZnF_C2H2 468 490 3.44e-4 SMART
ZnF_C2H2 496 518 8.47e-4 SMART
ZnF_C2H2 524 546 4.54e-4 SMART
ZnF_C2H2 552 574 7.9e-4 SMART
ZnF_C2H2 580 602 1.72e-4 SMART
ZnF_C2H2 633 655 1.98e-4 SMART
ZnF_C2H2 661 683 4.79e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229782
Predicted Effect probably benign
Transcript: ENSMUST00000229831
Predicted Effect probably benign
Transcript: ENSMUST00000229990
Predicted Effect probably benign
Transcript: ENSMUST00000230106
AA Change: M684T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000230214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230954
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 94% (64/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik A T 11: 11,589,375 probably null Het
Abtb2 G T 2: 103,567,063 G113C probably damaging Het
Acsm5 A G 7: 119,534,811 T272A probably damaging Het
Adprhl2 C T 4: 126,317,309 E272K possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Atp7b A C 8: 22,028,456 I122S possibly damaging Het
B230219D22Rik T C 13: 55,699,475 Y134H probably damaging Het
Bnc1 A G 7: 81,968,714 S868P probably damaging Het
Camta1 T C 4: 151,145,469 E302G probably damaging Het
Car1 A G 3: 14,770,873 Y129H probably damaging Het
Cdh22 T C 2: 165,142,277 T352A probably benign Het
Ckmt2 T C 13: 91,861,163 E215G probably benign Het
Cyb5r4 T G 9: 87,059,077 probably null Het
Dhrs13 A G 11: 78,032,430 probably benign Het
Dsg1c G A 18: 20,264,844 A34T probably benign Het
Epb41l1 T C 2: 156,521,410 V613A probably benign Het
Fam114a1 A G 5: 65,009,045 M240V probably damaging Het
Gm15455 T C 1: 33,838,176 noncoding transcript Het
Herc1 T G 9: 66,476,460 probably benign Het
Ifna11 T C 4: 88,820,077 V40A probably benign Het
Ifna15 T C 4: 88,558,029 N73D probably benign Het
Imp4 A T 1: 34,442,935 L45F probably damaging Het
Jak3 G A 8: 71,686,058 A967T probably damaging Het
Krtap19-2 A T 16: 88,874,028 Y76* probably null Het
Map4k5 A T 12: 69,824,614 N492K probably damaging Het
Mycbp2 C T 14: 103,296,939 R372H probably damaging Het
Nos2 G A 11: 78,922,314 S16N probably benign Het
Nr2c2 A G 6: 92,139,822 T2A probably damaging Het
Nup188 T C 2: 30,309,220 Y267H probably damaging Het
Nxph2 G A 2: 23,321,544 probably null Het
Olfr1446 T A 19: 12,890,406 H57L probably damaging Het
Olfr1461 T A 19: 13,165,591 D192E probably benign Het
Olfr1505 T A 19: 13,919,458 V146E possibly damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Pik3r1 C T 13: 101,689,444 R37Q probably damaging Het
Pkn3 T C 2: 30,085,281 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Ptpn14 T C 1: 189,786,886 S38P probably damaging Het
Raf1 G A 6: 115,620,235 Q35* probably null Het
Rps3a1 C A 3: 86,138,031 E251D probably benign Het
Scd1 C T 19: 44,401,709 V207M probably damaging Het
Shq1 A G 6: 100,630,993 V319A probably benign Het
Slc4a8 T C 15: 100,795,821 Y416H probably damaging Het
Slco1a5 T C 6: 142,262,637 T143A probably benign Het
Slco1a5 C T 6: 142,266,364 G90D probably damaging Het
Snx9 T C 17: 5,887,073 V30A probably benign Het
Spdya T C 17: 71,588,566 probably benign Het
Stat1 A T 1: 52,123,209 N75I probably damaging Het
Sv2b A T 7: 75,157,425 M159K probably damaging Het
Tdh A T 14: 63,496,126 Y89* probably null Het
Tmc7 A G 7: 118,543,365 F600S probably damaging Het
Trpa1 T A 1: 14,910,866 H104L probably damaging Het
Ttn G A 2: 76,848,640 probably benign Het
Vmn1r113 A G 7: 20,787,494 I70M possibly damaging Het
Vmn1r171 A G 7: 23,632,763 M138V probably benign Het
Zfc3h1 G A 10: 115,404,211 V550I probably benign Het
Zfp335 G T 2: 164,910,644 S60* probably null Het
Zfp984 T A 4: 147,755,446 H316L probably damaging Het
Zmym2 T A 14: 56,956,180 Y1151N possibly damaging Het
Other mutations in Zfp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Zfp7 APN 15 76890901 intron probably benign
IGL01509:Zfp7 APN 15 76881133 missense probably damaging 1.00
IGL01694:Zfp7 APN 15 76890795 nonsense probably null
IGL01731:Zfp7 APN 15 76888305 nonsense probably null
IGL02025:Zfp7 APN 15 76888264 missense probably damaging 1.00
R0841:Zfp7 UTSW 15 76891504 missense probably damaging 1.00
R1345:Zfp7 UTSW 15 76890708 missense probably damaging 1.00
R1625:Zfp7 UTSW 15 76881174 missense probably damaging 1.00
R1872:Zfp7 UTSW 15 76891777 missense probably benign 0.00
R2330:Zfp7 UTSW 15 76891309 missense probably damaging 1.00
R4170:Zfp7 UTSW 15 76891618 missense probably benign 0.00
R4795:Zfp7 UTSW 15 76891346 nonsense probably null
R4796:Zfp7 UTSW 15 76891346 nonsense probably null
R5277:Zfp7 UTSW 15 76881203 missense probably damaging 1.00
R5285:Zfp7 UTSW 15 76891222 missense probably damaging 1.00
R5287:Zfp7 UTSW 15 76891222 missense probably damaging 1.00
R5445:Zfp7 UTSW 15 76890854 nonsense probably null
R5655:Zfp7 UTSW 15 76891429 missense probably damaging 1.00
R6320:Zfp7 UTSW 15 76890610 missense possibly damaging 0.79
R7063:Zfp7 UTSW 15 76891719 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTGAAAGTCCCACCGTTTTGAAC -3'
(R):5'- GGCTTCTGGCTTATTCATAGTTAC -3'

Sequencing Primer
(F):5'- tatccaccagcggattca -3'
(R):5'- TCACGATGTGAGCTCTAAGC -3'
Posted On2016-06-15