Incidental Mutation 'R0445:A2m'
ID39314
Institutional Source Beutler Lab
Gene Symbol A2m
Ensembl Gene ENSMUSG00000030111
Gene Namealpha-2-macroglobulin
SynonymsA2mp
MMRRC Submission 038646-MU
Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0445 (G1)
Quality Score141
Status Validated
Chromosome6
Chromosomal Location121635376-121679227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121657955 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 687 (T687I)
Ref Sequence ENSEMBL: ENSMUSP00000032203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032203]
Predicted Effect probably damaging
Transcript: ENSMUST00000032203
AA Change: T687I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: T687I

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:A2M_N 134 227 2.1e-20 PFAM
low complexity region 334 347 N/A INTRINSIC
A2M_N_2 465 613 2.04e-31 SMART
low complexity region 722 731 N/A INTRINSIC
A2M 738 828 2.31e-39 SMART
Pfam:Thiol-ester_cl 961 990 4.4e-18 PFAM
Pfam:A2M_comp 1010 1266 1.4e-98 PFAM
A2M_recep 1376 1463 2.69e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203413
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A C 17: 48,090,022 probably null Het
4932438A13Rik T C 3: 37,000,065 V3111A probably damaging Het
Acsbg1 A G 9: 54,615,895 S483P probably damaging Het
Adam22 T A 5: 8,180,591 probably benign Het
Aggf1 A G 13: 95,354,001 V595A possibly damaging Het
Aplf A T 6: 87,663,752 L71I probably damaging Het
Arid3c G T 4: 41,725,172 P292T probably benign Het
Brms1l T A 12: 55,861,406 Y213* probably null Het
C87436 T A 6: 86,449,850 S332T possibly damaging Het
Cad G A 5: 31,072,709 A1454T probably benign Het
Cdkn3 T C 14: 46,767,400 probably null Het
Cnot1 A G 8: 95,760,208 C624R probably damaging Het
Cntnap5c A T 17: 58,104,743 I541F probably benign Het
Cyhr1 T C 15: 76,648,257 H217R probably damaging Het
Dennd1b A G 1: 139,167,765 probably benign Het
Dscam A T 16: 96,772,503 I753N probably damaging Het
Eef2 C CN 10: 81,178,770 probably null Het
Epg5 T A 18: 78,014,184 V1826D possibly damaging Het
Epha8 T C 4: 136,932,400 Y755C probably damaging Het
Esco1 A T 18: 10,574,989 N694K probably damaging Het
Fermt3 T C 19: 7,003,299 H300R probably benign Het
Galnt5 C A 2: 57,998,950 F187L probably benign Het
Gm17067 A G 7: 42,708,622 I152T probably benign Het
Gnb3 T C 6: 124,837,255 D154G possibly damaging Het
Gpr155 G A 2: 73,370,144 probably benign Het
Hdac3 A G 18: 37,943,724 I240T probably damaging Het
Ifitm1 A T 7: 140,968,441 probably null Het
Kif1b A T 4: 149,188,009 L1455Q probably benign Het
Krt1 A C 15: 101,847,621 L388R probably damaging Het
Lrp1 T A 10: 127,590,636 K635* probably null Het
Map3k2 A G 18: 32,217,210 Y371C probably damaging Het
Mcu T C 10: 59,456,645 probably benign Het
Mkrn1 C T 6: 39,404,854 V167I probably benign Het
Mrpl9 T A 3: 94,444,891 probably benign Het
Naip2 T C 13: 100,161,887 Y547C possibly damaging Het
Nup88 G A 11: 70,947,729 T487I probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Obscn C T 11: 58,999,335 R7457H unknown Het
Olfr1383 T A 11: 49,523,957 V78E probably damaging Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Paf1 T C 7: 28,395,688 S118P probably damaging Het
Parp4 T A 14: 56,602,748 probably null Het
Pcdh15 A T 10: 74,342,549 Y157F probably damaging Het
Pex10 G A 4: 155,069,074 probably null Het
Phrf1 C T 7: 141,247,331 probably benign Het
Polr3a G T 14: 24,454,921 D1090E probably benign Het
Ppfia4 A C 1: 134,327,289 L276R probably benign Het
Rdh16f1 T C 10: 127,790,867 L263S probably benign Het
Ryr3 T C 2: 112,866,054 D967G probably benign Het
Shc1 G T 3: 89,426,537 A226S probably damaging Het
Slc4a1 A G 11: 102,354,366 V585A probably benign Het
Stk38l T A 6: 146,775,686 S461T probably benign Het
Tbkbp1 A T 11: 97,149,469 S40T probably damaging Het
Tet1 A G 10: 62,879,941 M25T probably benign Het
Themis A G 10: 28,782,011 R192G probably damaging Het
Tmem144 T C 3: 79,825,354 T206A probably benign Het
Tmem74b G A 2: 151,706,959 R202H probably damaging Het
Trpm1 T C 7: 64,244,842 probably benign Het
Vars A G 17: 35,011,809 H557R probably benign Het
Zbtb12 C A 17: 34,896,301 A354E possibly damaging Het
Zfp143 A T 7: 110,061,117 probably benign Het
Other mutations in A2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:A2m APN 6 121644149 missense possibly damaging 0.67
IGL00798:A2m APN 6 121671010 missense probably damaging 1.00
IGL01154:A2m APN 6 121673542 nonsense probably null
IGL01313:A2m APN 6 121645010 critical splice donor site probably null
IGL01337:A2m APN 6 121668570 missense probably damaging 0.98
IGL01505:A2m APN 6 121676947 missense possibly damaging 0.83
IGL01508:A2m APN 6 121659367 nonsense probably null
IGL01672:A2m APN 6 121641357 missense probably damaging 1.00
IGL01951:A2m APN 6 121667190 missense possibly damaging 0.78
IGL02012:A2m APN 6 121674861 missense probably damaging 1.00
IGL02066:A2m APN 6 121649895 missense probably damaging 1.00
IGL02234:A2m APN 6 121668220 missense possibly damaging 0.67
IGL02397:A2m APN 6 121646875 missense probably benign
IGL02407:A2m APN 6 121668616 nonsense probably null
IGL02408:A2m APN 6 121644171 missense probably damaging 0.99
IGL02469:A2m APN 6 121668115 missense probably damaging 1.00
IGL02527:A2m APN 6 121661433 missense probably damaging 0.99
IGL02612:A2m APN 6 121678012 missense probably benign
IGL02746:A2m APN 6 121669503 splice site probably benign
IGL02952:A2m APN 6 121678025 missense probably damaging 0.99
IGL03056:A2m APN 6 121670903 missense probably damaging 0.96
IGL03121:A2m APN 6 121641306 missense probably benign 0.02
IGL03303:A2m APN 6 121667163 missense probably damaging 1.00
IGL03369:A2m APN 6 121676903 critical splice acceptor site probably null
IGL03046:A2m UTSW 6 121659323 missense probably benign 0.04
R0040:A2m UTSW 6 121645206 missense possibly damaging 0.93
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0109:A2m UTSW 6 121659303 missense probably benign 0.00
R0147:A2m UTSW 6 121662446 critical splice donor site probably null
R0148:A2m UTSW 6 121662446 critical splice donor site probably null
R0345:A2m UTSW 6 121638272 splice site probably benign
R0766:A2m UTSW 6 121676890 splice site probably benign
R1186:A2m UTSW 6 121661534 missense probably benign 0.00
R1436:A2m UTSW 6 121644213 missense probably benign 0.09
R1452:A2m UTSW 6 121678056 missense probably benign 0.01
R1636:A2m UTSW 6 121654612 missense probably benign 0.04
R1637:A2m UTSW 6 121654612 missense probably benign 0.04
R1638:A2m UTSW 6 121654612 missense probably benign 0.04
R1698:A2m UTSW 6 121645158 missense possibly damaging 0.88
R1776:A2m UTSW 6 121641424 missense probably damaging 1.00
R1791:A2m UTSW 6 121654612 missense probably benign 0.04
R1918:A2m UTSW 6 121644936 missense probably benign 0.16
R1921:A2m UTSW 6 121654612 missense probably benign 0.04
R1927:A2m UTSW 6 121636379 missense probably damaging 1.00
R1934:A2m UTSW 6 121649833 missense probably damaging 0.98
R1943:A2m UTSW 6 121668547 missense possibly damaging 0.90
R1996:A2m UTSW 6 121669597 missense probably damaging 1.00
R2039:A2m UTSW 6 121659949 missense probably benign 0.32
R2085:A2m UTSW 6 121676959 missense probably damaging 1.00
R2092:A2m UTSW 6 121674937 nonsense probably null
R2105:A2m UTSW 6 121673500 missense probably benign 0.04
R2107:A2m UTSW 6 121654612 missense probably benign 0.04
R2235:A2m UTSW 6 121642064 missense probably benign 0.21
R2292:A2m UTSW 6 121673559 missense possibly damaging 0.90
R2350:A2m UTSW 6 121678088 splice site probably benign
R3001:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3002:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3023:A2m UTSW 6 121669572 missense probably benign 0.08
R3429:A2m UTSW 6 121636290 start codon destroyed probably null
R3437:A2m UTSW 6 121639294 missense probably null 0.03
R3909:A2m UTSW 6 121648166 missense probably damaging 1.00
R4300:A2m UTSW 6 121673475 missense probably benign 0.00
R4332:A2m UTSW 6 121657447 missense probably benign 0.01
R4584:A2m UTSW 6 121657406 missense probably benign 0.07
R4697:A2m UTSW 6 121638284 start codon destroyed probably null 0.94
R4710:A2m UTSW 6 121641303 missense probably benign 0.03
R4841:A2m UTSW 6 121646844 missense probably benign 0.06
R5206:A2m UTSW 6 121674807 missense probably damaging 1.00
R5219:A2m UTSW 6 121676950 missense possibly damaging 0.90
R5230:A2m UTSW 6 121674861 missense probably damaging 1.00
R5330:A2m UTSW 6 121638416 missense probably benign 0.11
R5331:A2m UTSW 6 121638416 missense probably benign 0.11
R5377:A2m UTSW 6 121645253 missense probably benign
R5590:A2m UTSW 6 121676932 missense probably damaging 1.00
R5835:A2m UTSW 6 121639336 missense probably damaging 1.00
R5910:A2m UTSW 6 121668117 missense probably damaging 1.00
R5915:A2m UTSW 6 121667163 missense probably damaging 1.00
R5949:A2m UTSW 6 121678073 missense probably damaging 1.00
R5994:A2m UTSW 6 121670903 missense probably benign 0.38
R5996:A2m UTSW 6 121659394 missense probably damaging 1.00
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6090:A2m UTSW 6 121648013 missense probably benign 0.45
R6241:A2m UTSW 6 121646829 missense probably benign 0.09
R6294:A2m UTSW 6 121654481 missense probably benign
R6492:A2m UTSW 6 121654505 missense probably benign 0.35
R6554:A2m UTSW 6 121641287 missense probably damaging 1.00
R6597:A2m UTSW 6 121648121 missense probably damaging 1.00
R6742:A2m UTSW 6 121678036 missense probably benign 0.01
R6795:A2m UTSW 6 121648322 intron probably null
R6843:A2m UTSW 6 121638401 missense probably benign 0.01
X0057:A2m UTSW 6 121668176 missense probably damaging 1.00
X0060:A2m UTSW 6 121676080 missense probably damaging 1.00
X0063:A2m UTSW 6 121646876 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGCAGCAGAATCAGGTCCATAAG -3'
(R):5'- TGACTGACTGCTCAGAGTCCATCC -3'

Sequencing Primer
(F):5'- GCTTTGTGATATTTATACGCACTGC -3'
(R):5'- TGCTGGATCTGCACGTC -3'
Posted On2013-05-23